Incidental Mutation 'R2247:Nin'
ID 240911
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
MMRRC Submission 040247-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2247 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 70058209-70160491 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70101319 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 426 (Y426C)
Ref Sequence ENSEMBL: ENSMUSP00000152350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
AlphaFold Q61043
Predicted Effect probably damaging
Transcript: ENSMUST00000021468
AA Change: Y426C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: Y426C

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085314
AA Change: Y426C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: Y426C

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095666
AA Change: Y426C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: Y426C

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169074
AA Change: Y426C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: Y426C

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220689
AA Change: Y426C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221486
Predicted Effect probably damaging
Transcript: ENSMUST00000222237
AA Change: Y426C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222835
AA Change: Y426C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223257
AA Change: Y426C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223316
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg3 A G 17: 57,184,435 (GRCm39) E70G possibly damaging Het
Ash1l C A 3: 88,914,674 (GRCm39) P1768Q possibly damaging Het
Bicra C A 7: 15,723,159 (GRCm39) E119D probably benign Het
Brd2 A G 17: 34,333,389 (GRCm39) F421L probably damaging Het
Cspp1 A T 1: 10,136,685 (GRCm39) Q182L possibly damaging Het
Dnah7b A G 1: 46,316,223 (GRCm39) D3112G probably damaging Het
Dsc2 T A 18: 20,168,369 (GRCm39) I697F probably damaging Het
Ephb1 A T 9: 101,874,010 (GRCm39) S555T probably damaging Het
Fat4 A T 3: 38,946,198 (GRCm39) D1697V probably damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Impg2 A G 16: 56,088,627 (GRCm39) K1160R probably damaging Het
Jak2 T C 19: 29,261,036 (GRCm39) V344A probably benign Het
Kcnab3 A G 11: 69,221,016 (GRCm39) T168A probably damaging Het
Kctd18 A T 1: 58,006,801 (GRCm39) H16Q possibly damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myh11 A G 16: 14,095,423 (GRCm39) L113P probably damaging Het
Myh13 A T 11: 67,225,384 (GRCm39) I250F probably damaging Het
Or10ab4 C T 7: 107,654,989 (GRCm39) R267C probably benign Het
Or51ab3 T A 7: 103,201,097 (GRCm39) probably null Het
Pbrm1 A G 14: 30,796,850 (GRCm39) H897R probably damaging Het
Pgap4 T C 4: 49,586,209 (GRCm39) S320G probably benign Het
Plcl2 T C 17: 50,913,873 (GRCm39) V294A probably damaging Het
Psapl1 A G 5: 36,362,410 (GRCm39) E334G probably benign Het
Pwwp3a A G 10: 80,076,259 (GRCm39) Y483C probably damaging Het
Raly A G 2: 154,705,953 (GRCm39) H277R possibly damaging Het
Ranbp9 T C 13: 43,565,901 (GRCm39) K462E probably damaging Het
Rptn A G 3: 93,304,136 (GRCm39) T490A probably benign Het
Rtl1 T C 12: 109,561,413 (GRCm39) H142R possibly damaging Het
Scart2 G A 7: 139,829,042 (GRCm39) G234S probably null Het
Shisa3 G A 5: 67,768,666 (GRCm39) V189M probably benign Het
Slc25a36 A T 9: 96,982,191 (GRCm39) L28Q probably damaging Het
Slc38a8 A G 8: 120,212,389 (GRCm39) M318T probably benign Het
Slc4a11 A T 2: 130,529,721 (GRCm39) M328K probably benign Het
Sp2 A C 11: 96,852,844 (GRCm39) probably null Het
Sult2b1 A T 7: 45,384,734 (GRCm39) I114N probably damaging Het
Synrg T C 11: 83,900,202 (GRCm39) S803P probably damaging Het
Tenm4 T A 7: 96,555,216 (GRCm39) D2603E probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,179,912 (GRCm39) probably null Het
Zfp189 T A 4: 49,530,393 (GRCm39) C499S possibly damaging Het
Zfp236 A G 18: 82,622,423 (GRCm39) F1621S possibly damaging Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70,076,862 (GRCm39) missense probably damaging 0.98
IGL00677:Nin APN 12 70,073,634 (GRCm39) missense probably damaging 1.00
IGL00823:Nin APN 12 70,061,567 (GRCm39) missense probably benign 0.01
IGL01103:Nin APN 12 70,103,532 (GRCm39) missense probably damaging 0.99
IGL01113:Nin APN 12 70,078,553 (GRCm39) missense probably damaging 1.00
IGL01420:Nin APN 12 70,092,188 (GRCm39) missense probably benign 0.08
IGL01556:Nin APN 12 70,089,962 (GRCm39) missense probably benign 0.01
IGL01663:Nin APN 12 70,090,439 (GRCm39) missense possibly damaging 0.72
IGL02002:Nin APN 12 70,109,473 (GRCm39) nonsense probably null
IGL02030:Nin APN 12 70,092,042 (GRCm39) missense probably damaging 1.00
IGL02202:Nin APN 12 70,102,210 (GRCm39) missense probably damaging 1.00
IGL02207:Nin APN 12 70,103,431 (GRCm39) missense probably damaging 0.99
IGL02257:Nin APN 12 70,149,465 (GRCm39) missense possibly damaging 0.71
IGL02394:Nin APN 12 70,090,805 (GRCm39) missense probably damaging 1.00
IGL02531:Nin APN 12 70,067,706 (GRCm39) missense probably benign 0.02
IGL03028:Nin APN 12 70,082,044 (GRCm39) missense probably benign 0.13
IGL03155:Nin APN 12 70,078,544 (GRCm39) missense probably damaging 1.00
IGL03197:Nin APN 12 70,073,584 (GRCm39) missense probably benign 0.03
IGL02835:Nin UTSW 12 70,103,512 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0132:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0734:Nin UTSW 12 70,076,887 (GRCm39) missense probably benign 0.01
R0947:Nin UTSW 12 70,107,960 (GRCm39) missense probably damaging 1.00
R1085:Nin UTSW 12 70,067,736 (GRCm39) missense possibly damaging 0.91
R1367:Nin UTSW 12 70,090,703 (GRCm39) missense probably damaging 0.99
R1452:Nin UTSW 12 70,064,424 (GRCm39) nonsense probably null
R1477:Nin UTSW 12 70,090,958 (GRCm39) missense possibly damaging 0.87
R1518:Nin UTSW 12 70,061,547 (GRCm39) missense probably benign 0.27
R1566:Nin UTSW 12 70,101,253 (GRCm39) missense probably damaging 0.99
R1572:Nin UTSW 12 70,085,524 (GRCm39) missense probably damaging 1.00
R1583:Nin UTSW 12 70,078,512 (GRCm39) missense probably benign
R1584:Nin UTSW 12 70,089,443 (GRCm39) missense probably benign 0.03
R1699:Nin UTSW 12 70,092,337 (GRCm39) missense possibly damaging 0.87
R1699:Nin UTSW 12 70,077,712 (GRCm39) missense probably benign 0.40
R1765:Nin UTSW 12 70,089,665 (GRCm39) missense probably damaging 1.00
R1794:Nin UTSW 12 70,090,569 (GRCm39) nonsense probably null
R1952:Nin UTSW 12 70,077,700 (GRCm39) missense probably damaging 1.00
R2004:Nin UTSW 12 70,072,251 (GRCm39) missense probably benign 0.01
R2025:Nin UTSW 12 70,076,782 (GRCm39) missense probably damaging 1.00
R2060:Nin UTSW 12 70,089,192 (GRCm39) missense possibly damaging 0.64
R2213:Nin UTSW 12 70,092,128 (GRCm39) missense probably damaging 1.00
R2224:Nin UTSW 12 70,108,004 (GRCm39) missense probably damaging 1.00
R2972:Nin UTSW 12 70,109,487 (GRCm39) missense probably damaging 1.00
R3776:Nin UTSW 12 70,085,456 (GRCm39) missense possibly damaging 0.71
R3881:Nin UTSW 12 70,089,315 (GRCm39) missense probably benign 0.00
R3930:Nin UTSW 12 70,125,016 (GRCm39) missense probably damaging 1.00
R3959:Nin UTSW 12 70,097,526 (GRCm39) missense probably damaging 1.00
R4229:Nin UTSW 12 70,097,984 (GRCm39) missense probably damaging 0.99
R4359:Nin UTSW 12 70,061,712 (GRCm39) missense probably benign 0.00
R4423:Nin UTSW 12 70,089,752 (GRCm39) missense probably damaging 1.00
R4461:Nin UTSW 12 70,089,359 (GRCm39) missense probably benign 0.37
R4639:Nin UTSW 12 70,085,375 (GRCm39) missense probably damaging 0.97
R4791:Nin UTSW 12 70,090,581 (GRCm39) missense possibly damaging 0.94
R4839:Nin UTSW 12 70,137,325 (GRCm39) missense possibly damaging 0.46
R4912:Nin UTSW 12 70,090,837 (GRCm39) missense probably damaging 1.00
R5712:Nin UTSW 12 70,089,543 (GRCm39) missense probably damaging 1.00
R5726:Nin UTSW 12 70,124,953 (GRCm39) missense probably damaging 1.00
R5804:Nin UTSW 12 70,092,375 (GRCm39) missense possibly damaging 0.58
R5874:Nin UTSW 12 70,077,692 (GRCm39) missense possibly damaging 0.94
R5992:Nin UTSW 12 70,092,298 (GRCm39) missense possibly damaging 0.83
R6077:Nin UTSW 12 70,066,006 (GRCm39) missense probably damaging 1.00
R6184:Nin UTSW 12 70,090,511 (GRCm39) missense probably damaging 1.00
R6307:Nin UTSW 12 70,061,631 (GRCm39) missense possibly damaging 0.91
R6315:Nin UTSW 12 70,092,389 (GRCm39) missense probably damaging 1.00
R6326:Nin UTSW 12 70,091,955 (GRCm39) missense possibly damaging 0.95
R6492:Nin UTSW 12 70,101,308 (GRCm39) missense probably benign 0.22
R6562:Nin UTSW 12 70,102,728 (GRCm39) missense probably damaging 1.00
R6578:Nin UTSW 12 70,107,968 (GRCm39) missense probably damaging 0.99
R6613:Nin UTSW 12 70,077,728 (GRCm39) missense probably damaging 1.00
R7112:Nin UTSW 12 70,149,573 (GRCm39) missense
R7170:Nin UTSW 12 70,091,013 (GRCm39) missense
R7324:Nin UTSW 12 70,090,508 (GRCm39) missense
R7338:Nin UTSW 12 70,090,838 (GRCm39) missense
R7372:Nin UTSW 12 70,102,803 (GRCm39) missense
R7431:Nin UTSW 12 70,124,997 (GRCm39) missense
R7577:Nin UTSW 12 70,109,480 (GRCm39) missense
R7655:Nin UTSW 12 70,089,542 (GRCm39) missense
R7656:Nin UTSW 12 70,089,542 (GRCm39) missense
R7683:Nin UTSW 12 70,124,956 (GRCm39) missense
R7769:Nin UTSW 12 70,090,004 (GRCm39) missense
R7981:Nin UTSW 12 70,089,591 (GRCm39) missense
R8138:Nin UTSW 12 70,089,672 (GRCm39) missense
R8141:Nin UTSW 12 70,076,795 (GRCm39) missense
R8754:Nin UTSW 12 70,077,787 (GRCm39) intron probably benign
R8790:Nin UTSW 12 70,067,793 (GRCm39) missense
R8899:Nin UTSW 12 70,077,710 (GRCm39) missense probably damaging 1.00
R8974:Nin UTSW 12 70,124,932 (GRCm39) missense
R9085:Nin UTSW 12 70,076,786 (GRCm39) nonsense probably null
R9143:Nin UTSW 12 70,137,349 (GRCm39) missense
R9380:Nin UTSW 12 70,074,805 (GRCm39) missense
R9496:Nin UTSW 12 70,102,762 (GRCm39) missense
R9638:Nin UTSW 12 70,067,618 (GRCm39) missense
R9709:Nin UTSW 12 70,149,468 (GRCm39) missense
R9745:Nin UTSW 12 70,089,899 (GRCm39) missense
R9792:Nin UTSW 12 70,094,009 (GRCm39) missense
Z1176:Nin UTSW 12 70,095,938 (GRCm39) critical splice acceptor site probably null
Z1177:Nin UTSW 12 70,101,200 (GRCm39) missense
Z1177:Nin UTSW 12 70,090,869 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GGAGAATCCTTGGGTTTAGCCC -3'
(R):5'- TGACTGCAGAGGTCTAGCTG -3'

Sequencing Primer
(F):5'- GCTCTGTGCAGATACCTAGCATAG -3'
(R):5'- AGAGGTCTAGCTGCAGCC -3'
Posted On 2014-10-15