Incidental Mutation 'R2247:1700061G19Rik'
ID240920
Institutional Source Beutler Lab
Gene Symbol 1700061G19Rik
Ensembl Gene ENSMUSG00000024209
Gene NameRIKEN cDNA 1700061G19 gene
Synonyms
MMRRC Submission 040247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2247 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56875477-56888904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56877435 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 70 (E70G)
Ref Sequence ENSEMBL: ENSMUSP00000025048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025048] [ENSMUST00000043062]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025048
AA Change: E70G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025048
Gene: ENSMUSG00000024209
AA Change: E70G

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:AMP-binding 80 554 6.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043062
SMART Domains Protein: ENSMUSP00000042352
Gene: ENSMUSG00000024207

DomainStartEndE-ValueType
Pfam:AMP-binding 53 519 7e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125425
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Cspp1 A T 1: 10,066,460 Q182L possibly damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Kctd18 A T 1: 57,967,642 H16Q possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Psapl1 A G 5: 36,205,066 E334G probably benign Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rptn A G 3: 93,396,829 T490A probably benign Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Shisa3 G A 5: 67,611,323 V189M probably benign Het
Slc25a36 A T 9: 97,100,138 L28Q probably damaging Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Slc4a11 A T 2: 130,687,801 M328K probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Sult2b1 A T 7: 45,735,310 I114N probably damaging Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tmem246 T C 4: 49,586,209 S320G probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably null Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in 1700061G19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:1700061G19Rik APN 17 56882203 nonsense probably null
IGL01833:1700061G19Rik APN 17 56881062 missense probably benign 0.02
IGL02420:1700061G19Rik APN 17 56880494 missense probably damaging 1.00
IGL02969:1700061G19Rik APN 17 56883751 missense probably damaging 1.00
IGL03054:1700061G19Rik UTSW 17 56886528 missense possibly damaging 0.67
R0197:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R0257:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0279:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0280:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0281:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0282:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0329:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0330:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0349:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0518:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0519:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0521:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0604:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0883:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R1561:1700061G19Rik UTSW 17 56877431 missense probably benign
R1779:1700061G19Rik UTSW 17 56885169 nonsense probably null
R2008:1700061G19Rik UTSW 17 56886478 missense probably benign 0.04
R2102:1700061G19Rik UTSW 17 56884949 nonsense probably null
R2484:1700061G19Rik UTSW 17 56882641 missense probably benign 0.00
R2917:1700061G19Rik UTSW 17 56885141 missense probably damaging 1.00
R3149:1700061G19Rik UTSW 17 56876348 missense probably benign
R3773:1700061G19Rik UTSW 17 56876262 start codon destroyed probably null 0.00
R4829:1700061G19Rik UTSW 17 56883500 splice site probably null
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4887:1700061G19Rik UTSW 17 56876324 missense possibly damaging 0.84
R5043:1700061G19Rik UTSW 17 56885198 missense probably damaging 1.00
R5112:1700061G19Rik UTSW 17 56877465 missense probably benign 0.03
R5161:1700061G19Rik UTSW 17 56882888 missense possibly damaging 0.84
R5214:1700061G19Rik UTSW 17 56886493 missense probably benign
R5287:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5403:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5779:1700061G19Rik UTSW 17 56881061 missense probably benign 0.02
R5997:1700061G19Rik UTSW 17 56876373 missense probably benign 0.02
R6198:1700061G19Rik UTSW 17 56882679 missense probably damaging 1.00
R6259:1700061G19Rik UTSW 17 56877513 missense probably benign 0.04
R6357:1700061G19Rik UTSW 17 56877591 critical splice donor site probably null
R6754:1700061G19Rik UTSW 17 56883358 missense probably damaging 0.99
R6842:1700061G19Rik UTSW 17 56877432 missense probably benign 0.00
R7042:1700061G19Rik UTSW 17 56885098 missense possibly damaging 0.73
R7181:1700061G19Rik UTSW 17 56881037 missense probably benign 0.03
R7445:1700061G19Rik UTSW 17 56882973 missense possibly damaging 0.64
R7511:1700061G19Rik UTSW 17 56882954 missense probably damaging 0.98
R8122:1700061G19Rik UTSW 17 56886670 missense possibly damaging 0.50
Z1177:1700061G19Rik UTSW 17 56883463 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTGACAATGACTCCCTGTTC -3'
(R):5'- TGGACTTGCTTGCACAGGAG -3'

Sequencing Primer
(F):5'- GGAAGTGACTTCTGACCTTCTGC -3'
(R):5'- TTGCACAGGAGCCGTACCTTG -3'
Posted On2014-10-15