Incidental Mutation 'R2247:Tnfaip8'
ID240922
Institutional Source Beutler Lab
Gene Symbol Tnfaip8
Ensembl Gene ENSMUSG00000062210
Gene Nametumor necrosis factor, alpha-induced protein 8
SynonymsE130304C20Rik, Ssc-2, Nded, Gg2-1, Gm10539
MMRRC Submission 040247-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R2247 (G1)
Quality Score131
Status Not validated
Chromosome18
Chromosomal Location49979427-50107173 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC to ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC at 50046845 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126666] [ENSMUST00000128377] [ENSMUST00000134348] [ENSMUST00000145726] [ENSMUST00000148989] [ENSMUST00000153873] [ENSMUST00000179937] [ENSMUST00000180305]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124175
Predicted Effect probably benign
Transcript: ENSMUST00000126666
SMART Domains Protein: ENSMUSP00000121372
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 27 212 6.5e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128377
SMART Domains Protein: ENSMUSP00000136152
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 7 166 1.2e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129164
Predicted Effect probably benign
Transcript: ENSMUST00000134348
SMART Domains Protein: ENSMUSP00000119533
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 27 77 3.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145726
SMART Domains Protein: ENSMUSP00000136665
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 1 100 4.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148989
SMART Domains Protein: ENSMUSP00000120712
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 3 188 4.1e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153545
Predicted Effect probably benign
Transcript: ENSMUST00000153873
SMART Domains Protein: ENSMUSP00000115396
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 27 114 9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155403
Predicted Effect probably benign
Transcript: ENSMUST00000179937
SMART Domains Protein: ENSMUSP00000136030
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 3 134 1.1e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180305
SMART Domains Protein: ENSMUSP00000136682
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
low complexity region 23 59 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,435 E70G possibly damaging Het
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Cspp1 A T 1: 10,066,460 Q182L possibly damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Kctd18 A T 1: 57,967,642 H16Q possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Psapl1 A G 5: 36,205,066 E334G probably benign Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rptn A G 3: 93,396,829 T490A probably benign Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Shisa3 G A 5: 67,611,323 V189M probably benign Het
Slc25a36 A T 9: 97,100,138 L28Q probably damaging Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Slc4a11 A T 2: 130,687,801 M328K probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Sult2b1 A T 7: 45,735,310 I114N probably damaging Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tmem246 T C 4: 49,586,209 S320G probably benign Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in Tnfaip8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Tnfaip8 APN 18 50090326 missense probably damaging 1.00
IGL03391:Tnfaip8 APN 18 50090485 missense probably damaging 0.96
FR4304:Tnfaip8 UTSW 18 50046839 frame shift probably null
FR4449:Tnfaip8 UTSW 18 50046839 frame shift probably null
R0605:Tnfaip8 UTSW 18 50046845 small deletion probably benign
R1696:Tnfaip8 UTSW 18 50090223 nonsense probably null
R1804:Tnfaip8 UTSW 18 50090661 missense probably damaging 1.00
R3963:Tnfaip8 UTSW 18 50090586 missense possibly damaging 0.95
R4258:Tnfaip8 UTSW 18 50090376 missense possibly damaging 0.55
R4738:Tnfaip8 UTSW 18 50090502 missense probably damaging 1.00
R6229:Tnfaip8 UTSW 18 50051675 unclassified probably benign
R7786:Tnfaip8 UTSW 18 50047111 missense unknown
R7786:Tnfaip8 UTSW 18 50047112 missense unknown
RF024:Tnfaip8 UTSW 18 50046831 critical splice donor site probably benign
RF052:Tnfaip8 UTSW 18 50046833 frame shift probably null
RF062:Tnfaip8 UTSW 18 50046831 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- AACTGGACGTAGCTTCAACTGC -3'
(R):5'- CAACTTCCCAGCGCTGATAG -3'

Sequencing Primer
(F):5'- GGACGTAGCTTCAACTGCCAAAC -3'
(R):5'- TTACTGTGAAGCGTTCAGAAGCC -3'
Posted On2014-10-15