Incidental Mutation 'R2248:Abca2'
ID240929
Institutional Source Beutler Lab
Gene Symbol Abca2
Ensembl Gene ENSMUSG00000026944
Gene NameATP-binding cassette, sub-family A (ABC1), member 2
SynonymsAbc2, D2H0S1474E
MMRRC Submission 040248-MU
Accession Numbers

NCBI RefSeq: NM_007379.2; MGI: 99606

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2248 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25428703-25448540 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 25433464 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102919]
Predicted Effect probably benign
Transcript: ENSMUST00000102919
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (67/67)
MGI Phenotype Strain: 3697467; 3719855
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mice show tremors, hyperactivity, abnormal coordination, and alterations in CNS myelin sheath ultrastructure, [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,114 T482A probably benign Het
Afp A G 5: 90,501,570 D332G probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aldh1a2 A T 9: 71,215,862 I6F possibly damaging Het
Alg6 C T 4: 99,738,207 A84V probably damaging Het
Ank T A 15: 27,562,711 probably null Het
Ano5 A T 7: 51,593,789 M837L probably benign Het
Arl8b A G 6: 108,783,343 Y30C probably benign Het
Bfsp1 A T 2: 143,827,652 probably null Het
Cdhr1 C G 14: 37,081,377 V581L probably benign Het
Chst8 G T 7: 34,748,172 T7K probably damaging Het
Clca3b T C 3: 144,825,219 K790R probably benign Het
Clta A G 4: 44,012,852 N21D probably damaging Het
Col6a4 T G 9: 106,079,959 E222A probably benign Het
Dcc G T 18: 71,826,168 Q178K probably benign Het
Dpysl3 T C 18: 43,358,293 D140G possibly damaging Het
Dthd1 A T 5: 62,849,900 D648V probably damaging Het
Eva1c A G 16: 90,831,325 N18S probably benign Het
Flnc A G 6: 29,451,401 H1538R probably damaging Het
Foxn3 T C 12: 99,196,556 E362G probably benign Het
Frk C A 10: 34,608,531 T500K probably benign Het
Glipr1l1 A G 10: 112,062,287 E99G probably benign Het
Gm6169 C A 13: 97,098,898 V114F possibly damaging Het
Gphn T C 12: 78,454,821 L120P probably damaging Het
Gpr152 T C 19: 4,143,806 S449P probably benign Het
Greb1 T A 12: 16,680,378 I1655F possibly damaging Het
Hectd1 G T 12: 51,806,471 T89N probably damaging Het
Helz2 A C 2: 181,233,433 I1756S probably benign Het
Hydin G T 8: 110,578,203 R3825L probably benign Het
Ifi207 G A 1: 173,736,470 probably benign Het
Itpr3 A T 17: 27,115,059 E2035V probably damaging Het
Khnyn T A 14: 55,886,738 S150T probably benign Het
Kif21b T C 1: 136,172,966 I1595T probably damaging Het
Lgsn A T 1: 31,203,526 T230S possibly damaging Het
Limch1 G T 5: 67,044,399 G838V probably damaging Het
Lrp2 T A 2: 69,511,010 D942V probably damaging Het
Lrrc31 T A 3: 30,689,901 T153S possibly damaging Het
Mal2 T A 15: 54,588,336 I51N probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mycbp2 T A 14: 103,169,859 Q385L possibly damaging Het
Nav3 T A 10: 109,696,227 D2117V probably damaging Het
Ntn1 T C 11: 68,277,572 N353S possibly damaging Het
Oas1c T C 5: 120,802,861 E289G possibly damaging Het
Olfr1141 T C 2: 87,753,943 I17V probably null Het
Olfr1254 C A 2: 89,789,180 M57I possibly damaging Het
Olfr165 A G 16: 19,407,194 V274A probably damaging Het
Plk1 A G 7: 122,168,821 probably benign Het
Pms2 G A 5: 143,916,506 V230M probably damaging Het
Pole3 C A 4: 62,525,013 probably benign Het
Ppp2r5c T C 12: 110,485,923 F22S probably benign Het
Ptcd3 A T 6: 71,894,285 probably null Het
Ptprq A T 10: 107,643,070 probably null Het
Rab18 T A 18: 6,788,629 C199S probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Sacs A G 14: 61,212,802 N4099S probably damaging Het
Sh3yl1 T A 12: 30,942,870 probably null Het
Slco1c1 T A 6: 141,546,689 I217N probably damaging Het
Syne2 C T 12: 76,096,904 T6241I probably damaging Het
Tas2r119 T C 15: 32,178,151 F288L possibly damaging Het
Tmod2 G T 9: 75,592,649 T107N probably benign Het
Trappc6b T C 12: 59,050,381 T52A probably damaging Het
Tsen54 A G 11: 115,815,406 E122G probably damaging Het
Tspear A G 10: 77,873,269 N443S probably damaging Het
Unc80 A G 1: 66,623,206 probably benign Het
Virma T A 4: 11,518,927 Y725N probably damaging Het
Vwa7 G A 17: 35,019,043 D207N probably benign Het
Other mutations in Abca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Abca2 APN 2 25445963 splice site probably null
IGL01102:Abca2 APN 2 25433956 splice site probably benign
IGL01322:Abca2 APN 2 25446782 splice site probably null
IGL01402:Abca2 APN 2 25442003 missense probably damaging 1.00
IGL01419:Abca2 APN 2 25437514 missense probably damaging 1.00
IGL01490:Abca2 APN 2 25446011 missense probably damaging 1.00
IGL01633:Abca2 APN 2 25444394 missense possibly damaging 0.66
IGL01661:Abca2 APN 2 25442995 missense probably benign 0.01
IGL01804:Abca2 APN 2 25446625 missense probably damaging 1.00
IGL01933:Abca2 APN 2 25444111 missense probably damaging 1.00
IGL01941:Abca2 APN 2 25443095 missense probably benign 0.02
IGL02158:Abca2 APN 2 25447879 utr 3 prime probably benign
IGL02173:Abca2 APN 2 25441897 missense probably benign 0.00
IGL02419:Abca2 APN 2 25446837 missense probably benign
IGL02532:Abca2 APN 2 25435136 missense probably benign 0.03
IGL02572:Abca2 APN 2 25433317 missense possibly damaging 0.95
Abseiling UTSW 2 25447003 missense possibly damaging 0.65
R0126:Abca2 UTSW 2 25443730 missense possibly damaging 0.88
R0140:Abca2 UTSW 2 25438085 critical splice donor site probably null
R0372:Abca2 UTSW 2 25437353 missense probably damaging 1.00
R0437:Abca2 UTSW 2 25442845 missense probably damaging 0.99
R0505:Abca2 UTSW 2 25434894 missense probably benign 0.22
R0570:Abca2 UTSW 2 25447405 splice site probably null
R1037:Abca2 UTSW 2 25438228 splice site probably benign
R1283:Abca2 UTSW 2 25446689 missense probably damaging 1.00
R1448:Abca2 UTSW 2 25440530 missense possibly damaging 0.73
R1464:Abca2 UTSW 2 25447834 splice site probably benign
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1480:Abca2 UTSW 2 25433397 missense possibly damaging 0.60
R1545:Abca2 UTSW 2 25442358 missense probably benign 0.17
R1562:Abca2 UTSW 2 25446319 missense probably benign 0.43
R1569:Abca2 UTSW 2 25439185 missense probably benign 0.45
R1586:Abca2 UTSW 2 25447216 missense probably damaging 0.98
R1635:Abca2 UTSW 2 25444856 missense probably benign 0.03
R1699:Abca2 UTSW 2 25447351 missense possibly damaging 0.80
R1754:Abca2 UTSW 2 25434333 missense probably benign 0.01
R1760:Abca2 UTSW 2 25443043 missense probably benign 0.00
R2040:Abca2 UTSW 2 25443805 missense probably damaging 1.00
R2067:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2111:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2323:Abca2 UTSW 2 25445175 missense probably benign 0.00
R2418:Abca2 UTSW 2 25437989 missense probably benign 0.22
R2419:Abca2 UTSW 2 25437989 missense probably benign 0.22
R3816:Abca2 UTSW 2 25446071 missense probably damaging 1.00
R4180:Abca2 UTSW 2 25441578 missense possibly damaging 0.58
R4431:Abca2 UTSW 2 25442852 missense probably benign
R4468:Abca2 UTSW 2 25444902 missense probably damaging 1.00
R4704:Abca2 UTSW 2 25443412 missense probably damaging 0.99
R4839:Abca2 UTSW 2 25440909 missense probably damaging 0.99
R4933:Abca2 UTSW 2 25444827 missense probably benign 0.25
R4970:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R4971:Abca2 UTSW 2 25441994 missense probably damaging 0.97
R5112:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R5327:Abca2 UTSW 2 25445674 missense probably damaging 1.00
R5378:Abca2 UTSW 2 25446068 missense probably damaging 1.00
R5648:Abca2 UTSW 2 25436498 critical splice donor site probably null
R5725:Abca2 UTSW 2 25439400 missense probably damaging 0.98
R5825:Abca2 UTSW 2 25436736 missense probably benign 0.36
R5837:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5840:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5851:Abca2 UTSW 2 25442310 missense possibly damaging 0.58
R6262:Abca2 UTSW 2 25444910 missense possibly damaging 0.56
R6344:Abca2 UTSW 2 25437694 missense probably damaging 1.00
R6547:Abca2 UTSW 2 25433338 missense possibly damaging 0.80
R6640:Abca2 UTSW 2 25447003 missense possibly damaging 0.65
R6980:Abca2 UTSW 2 25440866 missense possibly damaging 0.89
R6981:Abca2 UTSW 2 25444139 missense probably damaging 1.00
R7070:Abca2 UTSW 2 25442995 missense probably benign 0.06
R7080:Abca2 UTSW 2 25446104 missense probably benign 0.37
R7187:Abca2 UTSW 2 25437721 missense probably damaging 1.00
R7195:Abca2 UTSW 2 25442076 missense probably benign 0.00
R7297:Abca2 UTSW 2 25442076 missense probably benign 0.00
R7487:Abca2 UTSW 2 25437903 missense probably benign 0.02
R7561:Abca2 UTSW 2 25446695 missense probably damaging 0.98
R7766:Abca2 UTSW 2 25441528 missense probably benign 0.04
RF063:Abca2 UTSW 2 25447397 missense probably damaging 1.00
RF064:Abca2 UTSW 2 25447397 missense probably damaging 1.00
Z1176:Abca2 UTSW 2 25444110 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCTTACGGTGTTCCAGGGTC -3'
(R):5'- GGAAACGCCAAAGCTCTCTC -3'

Sequencing Primer
(F):5'- GAGGGCAATTTGTTCGAC -3'
(R):5'- ACTGAGGGTCCAGCTCTAG -3'
Posted On2014-10-15