Incidental Mutation 'R2248:Lrp2'
ID 240930
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Name low density lipoprotein receptor-related protein 2
Synonyms Gp330, D230004K18Rik, b2b1625.2Clo, Megalin
MMRRC Submission 040248-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2248 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 69424340-69586065 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69511010 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 942 (D942V)
Ref Sequence ENSEMBL: ENSMUSP00000079752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953] [ENSMUST00000100051]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080953
AA Change: D942V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: D942V

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100051
AA Change: D942V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097628
Gene: ENSMUSG00000027070
AA Change: D942V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 6.18e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128742
Meta Mutation Damage Score 0.2489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,114 (GRCm38) T482A probably benign Het
Abca2 A G 2: 25,433,464 (GRCm38) probably benign Het
Afp A G 5: 90,501,570 (GRCm38) D332G probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 (GRCm38) probably benign Het
Aldh1a2 A T 9: 71,215,862 (GRCm38) I6F possibly damaging Het
Alg6 C T 4: 99,738,207 (GRCm38) A84V probably damaging Het
Ank T A 15: 27,562,711 (GRCm38) probably null Het
Ano5 A T 7: 51,593,789 (GRCm38) M837L probably benign Het
Arl8b A G 6: 108,783,343 (GRCm38) Y30C probably benign Het
Bfsp1 A T 2: 143,827,652 (GRCm38) probably null Het
Cdhr1 C G 14: 37,081,377 (GRCm38) V581L probably benign Het
Chst8 G T 7: 34,748,172 (GRCm38) T7K probably damaging Het
Clca3b T C 3: 144,825,219 (GRCm38) K790R probably benign Het
Clta A G 4: 44,012,852 (GRCm38) N21D probably damaging Het
Col6a4 T G 9: 106,079,959 (GRCm38) E222A probably benign Het
Dcc G T 18: 71,826,168 (GRCm38) Q178K probably benign Het
Dpysl3 T C 18: 43,358,293 (GRCm38) D140G possibly damaging Het
Dthd1 A T 5: 62,849,900 (GRCm38) D648V probably damaging Het
Eva1c A G 16: 90,831,325 (GRCm38) N18S probably benign Het
Flnc A G 6: 29,451,401 (GRCm38) H1538R probably damaging Het
Foxn3 T C 12: 99,196,556 (GRCm38) E362G probably benign Het
Frk C A 10: 34,608,531 (GRCm38) T500K probably benign Het
Glipr1l1 A G 10: 112,062,287 (GRCm38) E99G probably benign Het
Gm6169 C A 13: 97,098,898 (GRCm38) V114F possibly damaging Het
Gphn T C 12: 78,454,821 (GRCm38) L120P probably damaging Het
Gpr152 T C 19: 4,143,806 (GRCm38) S449P probably benign Het
Greb1 T A 12: 16,680,378 (GRCm38) I1655F possibly damaging Het
Hectd1 G T 12: 51,806,471 (GRCm38) T89N probably damaging Het
Helz2 A C 2: 181,233,433 (GRCm38) I1756S probably benign Het
Hydin G T 8: 110,578,203 (GRCm38) R3825L probably benign Het
Ifi207 G A 1: 173,736,470 (GRCm38) probably benign Het
Itpr3 A T 17: 27,115,059 (GRCm38) E2035V probably damaging Het
Khnyn T A 14: 55,886,738 (GRCm38) S150T probably benign Het
Kif21b T C 1: 136,172,966 (GRCm38) I1595T probably damaging Het
Lgsn A T 1: 31,203,526 (GRCm38) T230S possibly damaging Het
Limch1 G T 5: 67,044,399 (GRCm38) G838V probably damaging Het
Lrrc31 T A 3: 30,689,901 (GRCm38) T153S possibly damaging Het
Mal2 T A 15: 54,588,336 (GRCm38) I51N probably damaging Het
Mroh2a T C 1: 88,256,754 (GRCm38) V1453A probably benign Het
Mycbp2 T A 14: 103,169,859 (GRCm38) Q385L possibly damaging Het
Nav3 T A 10: 109,696,227 (GRCm38) D2117V probably damaging Het
Ntn1 T C 11: 68,277,572 (GRCm38) N353S possibly damaging Het
Oas1c T C 5: 120,802,861 (GRCm38) E289G possibly damaging Het
Olfr1141 T C 2: 87,753,943 (GRCm38) I17V probably null Het
Olfr1254 C A 2: 89,789,180 (GRCm38) M57I possibly damaging Het
Olfr165 A G 16: 19,407,194 (GRCm38) V274A probably damaging Het
Plk1 A G 7: 122,168,821 (GRCm38) probably benign Het
Pms2 G A 5: 143,916,506 (GRCm38) V230M probably damaging Het
Pole3 C A 4: 62,525,013 (GRCm38) probably benign Het
Ppp2r5c T C 12: 110,485,923 (GRCm38) F22S probably benign Het
Ptcd3 A T 6: 71,894,285 (GRCm38) probably null Het
Ptprq A T 10: 107,643,070 (GRCm38) probably null Het
Rab18 T A 18: 6,788,629 (GRCm38) C199S probably damaging Het
Rbp3 C T 14: 33,956,018 (GRCm38) T641M probably damaging Het
Sacs A G 14: 61,212,802 (GRCm38) N4099S probably damaging Het
Sh3yl1 T A 12: 30,942,870 (GRCm38) probably null Het
Slco1c1 T A 6: 141,546,689 (GRCm38) I217N probably damaging Het
Syne2 C T 12: 76,096,904 (GRCm38) T6241I probably damaging Het
Tas2r119 T C 15: 32,178,151 (GRCm38) F288L possibly damaging Het
Tmod2 G T 9: 75,592,649 (GRCm38) T107N probably benign Het
Trappc6b T C 12: 59,050,381 (GRCm38) T52A probably damaging Het
Tsen54 A G 11: 115,815,406 (GRCm38) E122G probably damaging Het
Tspear A G 10: 77,873,269 (GRCm38) N443S probably damaging Het
Unc80 A G 1: 66,623,206 (GRCm38) probably benign Het
Virma T A 4: 11,518,927 (GRCm38) Y725N probably damaging Het
Vwa7 G A 17: 35,019,043 (GRCm38) D207N probably benign Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69,507,779 (GRCm38) missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69,486,280 (GRCm38) missense probably benign 0.00
IGL00782:Lrp2 APN 2 69,501,645 (GRCm38) missense probably benign 0.14
IGL00821:Lrp2 APN 2 69,459,516 (GRCm38) missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69,521,881 (GRCm38) missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69,469,436 (GRCm38) missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69,524,073 (GRCm38) missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69,492,432 (GRCm38) nonsense probably null
IGL01131:Lrp2 APN 2 69,499,239 (GRCm38) missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69,510,984 (GRCm38) missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69,503,526 (GRCm38) missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69,552,470 (GRCm38) splice site probably benign
IGL01375:Lrp2 APN 2 69,478,566 (GRCm38) splice site probably benign
IGL01384:Lrp2 APN 2 69,483,502 (GRCm38) missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69,453,812 (GRCm38) missense probably null 1.00
IGL01411:Lrp2 APN 2 69,482,267 (GRCm38) missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69,525,286 (GRCm38) missense probably benign
IGL01444:Lrp2 APN 2 69,443,716 (GRCm38) missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69,472,439 (GRCm38) missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69,492,460 (GRCm38) missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69,428,706 (GRCm38) missense probably benign
IGL01761:Lrp2 APN 2 69,481,235 (GRCm38) missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69,486,184 (GRCm38) missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69,483,601 (GRCm38) missense probably benign 0.08
IGL02015:Lrp2 APN 2 69,527,578 (GRCm38) missense probably benign 0.00
IGL02104:Lrp2 APN 2 69,510,418 (GRCm38) missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69,537,616 (GRCm38) missense probably benign 0.01
IGL02134:Lrp2 APN 2 69,513,379 (GRCm38) critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69,466,880 (GRCm38) missense probably benign 0.01
IGL02212:Lrp2 APN 2 69,451,264 (GRCm38) missense probably benign 0.00
IGL02240:Lrp2 APN 2 69,535,046 (GRCm38) missense probably benign
IGL02248:Lrp2 APN 2 69,482,808 (GRCm38) missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69,464,636 (GRCm38) missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69,469,633 (GRCm38) missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69,461,305 (GRCm38) missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69,521,773 (GRCm38) missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69,464,801 (GRCm38) splice site probably benign
IGL02508:Lrp2 APN 2 69,503,430 (GRCm38) missense probably benign 0.04
IGL02751:Lrp2 APN 2 69,533,462 (GRCm38) missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69,506,736 (GRCm38) missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69,552,450 (GRCm38) missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69,552,450 (GRCm38) missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69,455,510 (GRCm38) missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69,487,837 (GRCm38) missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69,455,453 (GRCm38) splice site probably benign
IGL02990:Lrp2 APN 2 69,441,396 (GRCm38) missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69,537,553 (GRCm38) missense probably benign 0.43
IGL03038:Lrp2 APN 2 69,475,464 (GRCm38) missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69,483,133 (GRCm38) missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69,454,833 (GRCm38) missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69,477,026 (GRCm38) missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69,549,042 (GRCm38) missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69,455,452 (GRCm38) splice site probably benign
IGL03163:Lrp2 APN 2 69,501,526 (GRCm38) nonsense probably null
IGL03164:Lrp2 APN 2 69,464,699 (GRCm38) missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69,523,194 (GRCm38) missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69,466,265 (GRCm38) missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69,438,478 (GRCm38) splice site probably benign
IGL03288:Lrp2 APN 2 69,426,039 (GRCm38) missense probably benign 0.02
IGL03350:Lrp2 APN 2 69,438,453 (GRCm38) missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69,431,152 (GRCm38) missense probably damaging 1.00
casual UTSW 2 69,499,263 (GRCm38) missense probably benign
nonchalant UTSW 2 69,489,329 (GRCm38) missense probably damaging 1.00
Presto UTSW 2 69,459,531 (GRCm38) nonsense probably null
relaxed UTSW 2 69,535,005 (GRCm38) missense probably damaging 1.00
unguarded UTSW 2 69,465,758 (GRCm38) missense probably benign 0.00
Unintended UTSW 2 69,518,443 (GRCm38) missense probably damaging 1.00
BB009:Lrp2 UTSW 2 69,426,027 (GRCm38) missense probably benign 0.00
BB019:Lrp2 UTSW 2 69,426,027 (GRCm38) missense probably benign 0.00
IGL02835:Lrp2 UTSW 2 69,505,304 (GRCm38) missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69,458,448 (GRCm38) missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69,537,538 (GRCm38) missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69,475,403 (GRCm38) missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69,516,551 (GRCm38) missense probably benign 0.42
R0008:Lrp2 UTSW 2 69,516,551 (GRCm38) missense probably benign 0.42
R0044:Lrp2 UTSW 2 69,527,555 (GRCm38) missense probably benign 0.01
R0044:Lrp2 UTSW 2 69,527,555 (GRCm38) missense probably damaging 0.96
R0048:Lrp2 UTSW 2 69,465,627 (GRCm38) missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69,475,412 (GRCm38) missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69,475,412 (GRCm38) missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69,477,040 (GRCm38) missense probably benign
R0167:Lrp2 UTSW 2 69,425,658 (GRCm38) missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69,537,563 (GRCm38) missense probably null 1.00
R0243:Lrp2 UTSW 2 69,428,630 (GRCm38) missense probably benign 0.00
R0308:Lrp2 UTSW 2 69,482,982 (GRCm38) splice site probably benign
R0323:Lrp2 UTSW 2 69,469,639 (GRCm38) missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69,535,043 (GRCm38) missense probably benign 0.10
R0374:Lrp2 UTSW 2 69,430,307 (GRCm38) missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69,460,337 (GRCm38) splice site probably benign
R0391:Lrp2 UTSW 2 69,456,858 (GRCm38) missense probably damaging 0.99
R0395:Lrp2 UTSW 2 69,433,077 (GRCm38) missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69,479,148 (GRCm38) missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69,525,234 (GRCm38) missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69,507,801 (GRCm38) missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69,511,017 (GRCm38) missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69,428,654 (GRCm38) missense probably benign 0.00
R0544:Lrp2 UTSW 2 69,491,931 (GRCm38) missense probably benign 0.18
R0548:Lrp2 UTSW 2 69,537,638 (GRCm38) splice site probably benign
R0593:Lrp2 UTSW 2 69,467,006 (GRCm38) missense probably benign
R0608:Lrp2 UTSW 2 69,486,243 (GRCm38) missense probably benign 0.02
R0633:Lrp2 UTSW 2 69,448,120 (GRCm38) missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69,451,380 (GRCm38) missense probably benign 0.19
R0718:Lrp2 UTSW 2 69,510,948 (GRCm38) missense probably damaging 1.00
R0737:Lrp2 UTSW 2 69,448,169 (GRCm38) missense probably damaging 0.96
R0771:Lrp2 UTSW 2 69,507,990 (GRCm38) missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69,518,365 (GRCm38) missense probably benign 0.32
R0885:Lrp2 UTSW 2 69,482,353 (GRCm38) missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69,487,838 (GRCm38) missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69,524,036 (GRCm38) missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69,523,302 (GRCm38) splice site probably null
R1301:Lrp2 UTSW 2 69,428,604 (GRCm38) missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69,456,918 (GRCm38) missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69,483,394 (GRCm38) missense probably damaging 0.99
R1459:Lrp2 UTSW 2 69,460,477 (GRCm38) missense probably damaging 1.00
R1529:Lrp2 UTSW 2 69,523,182 (GRCm38) missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69,500,730 (GRCm38) missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69,502,610 (GRCm38) missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69,502,661 (GRCm38) missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69,466,763 (GRCm38) critical splice donor site probably null
R1689:Lrp2 UTSW 2 69,503,529 (GRCm38) missense probably benign 0.09
R1693:Lrp2 UTSW 2 69,510,418 (GRCm38) missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69,496,489 (GRCm38) missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69,503,530 (GRCm38) missense probably benign 0.04
R1834:Lrp2 UTSW 2 69,466,880 (GRCm38) missense probably benign 0.01
R1921:Lrp2 UTSW 2 69,523,287 (GRCm38) missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69,467,090 (GRCm38) missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69,507,843 (GRCm38) missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69,536,021 (GRCm38) missense probably benign 0.25
R2093:Lrp2 UTSW 2 69,536,021 (GRCm38) missense probably benign 0.25
R2108:Lrp2 UTSW 2 69,506,624 (GRCm38) missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69,483,385 (GRCm38) missense probably benign 0.05
R2122:Lrp2 UTSW 2 69,483,707 (GRCm38) missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69,511,067 (GRCm38) missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69,467,028 (GRCm38) missense possibly damaging 0.94
R2264:Lrp2 UTSW 2 69,482,366 (GRCm38) missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69,491,847 (GRCm38) missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69,506,374 (GRCm38) splice site probably null
R2984:Lrp2 UTSW 2 69,425,814 (GRCm38) splice site probably null
R3085:Lrp2 UTSW 2 69,467,135 (GRCm38) missense probably benign 0.05
R3103:Lrp2 UTSW 2 69,431,984 (GRCm38) missense probably benign 0.00
R3727:Lrp2 UTSW 2 69,510,429 (GRCm38) missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69,464,579 (GRCm38) missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69,534,907 (GRCm38) critical splice donor site probably null
R3731:Lrp2 UTSW 2 69,464,579 (GRCm38) missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69,534,907 (GRCm38) critical splice donor site probably null
R3764:Lrp2 UTSW 2 69,496,336 (GRCm38) missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69,505,105 (GRCm38) missense probably benign 0.34
R3778:Lrp2 UTSW 2 69,509,204 (GRCm38) missense probably benign 0.00
R3808:Lrp2 UTSW 2 69,501,548 (GRCm38) missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69,501,548 (GRCm38) missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69,464,579 (GRCm38) missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69,426,012 (GRCm38) missense probably benign 0.03
R3852:Lrp2 UTSW 2 69,537,565 (GRCm38) missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69,459,472 (GRCm38) critical splice donor site probably null
R3877:Lrp2 UTSW 2 69,549,047 (GRCm38) missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69,506,376 (GRCm38) missense probably benign
R4081:Lrp2 UTSW 2 69,513,273 (GRCm38) missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69,513,273 (GRCm38) missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69,430,262 (GRCm38) critical splice donor site probably null
R4193:Lrp2 UTSW 2 69,467,143 (GRCm38) missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69,480,094 (GRCm38) missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69,425,991 (GRCm38) nonsense probably null
R4352:Lrp2 UTSW 2 69,432,182 (GRCm38) critical splice donor site probably null
R4407:Lrp2 UTSW 2 69,502,517 (GRCm38) missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69,467,169 (GRCm38) missense probably benign 0.09
R4416:Lrp2 UTSW 2 69,527,231 (GRCm38) missense probably benign 0.18
R4426:Lrp2 UTSW 2 69,506,348 (GRCm38) missense probably benign 0.00
R4510:Lrp2 UTSW 2 69,480,062 (GRCm38) missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69,480,062 (GRCm38) missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69,513,285 (GRCm38) missense probably benign 0.13
R4591:Lrp2 UTSW 2 69,536,075 (GRCm38) missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69,458,427 (GRCm38) nonsense probably null
R4622:Lrp2 UTSW 2 69,460,349 (GRCm38) missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69,489,129 (GRCm38) splice site probably null
R4633:Lrp2 UTSW 2 69,461,417 (GRCm38) missense probably benign 0.16
R4636:Lrp2 UTSW 2 69,436,639 (GRCm38) missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69,466,993 (GRCm38) missense probably damaging 1.00
R4667:Lrp2 UTSW 2 69,489,298 (GRCm38) missense probably benign 0.02
R4712:Lrp2 UTSW 2 69,506,551 (GRCm38) missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69,487,966 (GRCm38) missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69,481,173 (GRCm38) missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69,533,555 (GRCm38) missense probably benign
R4733:Lrp2 UTSW 2 69,533,555 (GRCm38) missense probably benign
R4777:Lrp2 UTSW 2 69,482,264 (GRCm38) missense probably damaging 1.00
R4779:Lrp2 UTSW 2 69,459,715 (GRCm38) missense possibly damaging 0.75
R4786:Lrp2 UTSW 2 69,537,956 (GRCm38) missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69,469,411 (GRCm38) missense probably benign 0.06
R4845:Lrp2 UTSW 2 69,509,241 (GRCm38) missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69,479,113 (GRCm38) missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69,472,368 (GRCm38) missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69,535,988 (GRCm38) missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69,481,388 (GRCm38) missense probably benign 0.01
R5075:Lrp2 UTSW 2 69,465,758 (GRCm38) missense probably benign 0.00
R5078:Lrp2 UTSW 2 69,501,530 (GRCm38) missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69,489,158 (GRCm38) missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69,501,490 (GRCm38) missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69,430,342 (GRCm38) missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69,552,349 (GRCm38) splice site probably null
R5223:Lrp2 UTSW 2 69,524,053 (GRCm38) missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69,456,819 (GRCm38) splice site probably null
R5267:Lrp2 UTSW 2 69,548,978 (GRCm38) missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69,513,354 (GRCm38) missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69,525,228 (GRCm38) missense probably benign 0.01
R5355:Lrp2 UTSW 2 69,454,838 (GRCm38) nonsense probably null
R5356:Lrp2 UTSW 2 69,464,708 (GRCm38) missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69,459,560 (GRCm38) missense probably benign 0.04
R5486:Lrp2 UTSW 2 69,437,465 (GRCm38) missense probably benign 0.04
R5554:Lrp2 UTSW 2 69,552,424 (GRCm38) missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69,451,288 (GRCm38) missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69,464,624 (GRCm38) missense possibly damaging 0.77
R5587:Lrp2 UTSW 2 69,499,263 (GRCm38) missense probably benign
R5605:Lrp2 UTSW 2 69,523,299 (GRCm38) missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69,472,418 (GRCm38) missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69,519,914 (GRCm38) missense probably null 0.80
R5686:Lrp2 UTSW 2 69,511,061 (GRCm38) missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69,502,553 (GRCm38) missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69,451,382 (GRCm38) missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69,509,147 (GRCm38) missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69,466,877 (GRCm38) missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69,455,525 (GRCm38) missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69,480,153 (GRCm38) missense probably benign 0.00
R5892:Lrp2 UTSW 2 69,442,776 (GRCm38) missense probably benign
R5951:Lrp2 UTSW 2 69,496,323 (GRCm38) splice site probably null
R5974:Lrp2 UTSW 2 69,459,548 (GRCm38) missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69,535,005 (GRCm38) missense probably damaging 1.00
R6046:Lrp2 UTSW 2 69,506,754 (GRCm38) missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69,483,557 (GRCm38) missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69,511,001 (GRCm38) missense probably benign 0.00
R6177:Lrp2 UTSW 2 69,510,419 (GRCm38) frame shift probably null
R6180:Lrp2 UTSW 2 69,503,524 (GRCm38) missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69,469,478 (GRCm38) missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69,482,366 (GRCm38) missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69,466,340 (GRCm38) missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69,436,681 (GRCm38) missense probably damaging 1.00
R6337:Lrp2 UTSW 2 69,438,467 (GRCm38) missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69,483,443 (GRCm38) missense probably benign 0.02
R6385:Lrp2 UTSW 2 69,495,784 (GRCm38) missense probably benign 0.22
R6429:Lrp2 UTSW 2 69,461,287 (GRCm38) missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69,505,156 (GRCm38) missense probably benign 0.00
R6524:Lrp2 UTSW 2 69,436,639 (GRCm38) missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69,509,303 (GRCm38) missense probably benign 0.00
R6594:Lrp2 UTSW 2 69,439,923 (GRCm38) missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69,469,405 (GRCm38) missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69,453,858 (GRCm38) missense probably benign 0.01
R6718:Lrp2 UTSW 2 69,483,780 (GRCm38) missense probably benign 0.09
R6736:Lrp2 UTSW 2 69,448,211 (GRCm38) missense probably benign 0.02
R6738:Lrp2 UTSW 2 69,458,488 (GRCm38) missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69,483,904 (GRCm38) missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69,518,443 (GRCm38) missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69,513,268 (GRCm38) missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69,513,377 (GRCm38) missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69,524,141 (GRCm38) missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69,510,502 (GRCm38) missense probably benign
R6902:Lrp2 UTSW 2 69,459,503 (GRCm38) missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69,472,365 (GRCm38) missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69,489,305 (GRCm38) missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69,472,455 (GRCm38) missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69,483,208 (GRCm38) missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69,483,028 (GRCm38) missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69,521,787 (GRCm38) missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69,465,745 (GRCm38) missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69,454,808 (GRCm38) critical splice donor site probably null
R7150:Lrp2 UTSW 2 69,488,051 (GRCm38) missense probably damaging 0.99
R7165:Lrp2 UTSW 2 69,506,573 (GRCm38) missense probably damaging 0.99
R7174:Lrp2 UTSW 2 69,433,072 (GRCm38) missense probably benign 0.11
R7204:Lrp2 UTSW 2 69,472,533 (GRCm38) missense probably benign 0.25
R7275:Lrp2 UTSW 2 69,459,531 (GRCm38) nonsense probably null
R7278:Lrp2 UTSW 2 69,486,352 (GRCm38) missense probably damaging 1.00
R7296:Lrp2 UTSW 2 69,482,381 (GRCm38) missense probably benign 0.04
R7315:Lrp2 UTSW 2 69,491,822 (GRCm38) missense probably damaging 0.98
R7342:Lrp2 UTSW 2 69,479,290 (GRCm38) missense possibly damaging 0.95
R7351:Lrp2 UTSW 2 69,448,142 (GRCm38) missense probably damaging 1.00
R7352:Lrp2 UTSW 2 69,472,397 (GRCm38) missense probably benign 0.04
R7366:Lrp2 UTSW 2 69,483,806 (GRCm38) missense probably damaging 1.00
R7373:Lrp2 UTSW 2 69,500,692 (GRCm38) missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69,459,674 (GRCm38) missense probably damaging 0.99
R7446:Lrp2 UTSW 2 69,432,213 (GRCm38) missense probably damaging 1.00
R7451:Lrp2 UTSW 2 69,513,333 (GRCm38) missense probably damaging 1.00
R7492:Lrp2 UTSW 2 69,537,581 (GRCm38) missense probably damaging 0.99
R7571:Lrp2 UTSW 2 69,516,403 (GRCm38) missense probably damaging 1.00
R7638:Lrp2 UTSW 2 69,477,008 (GRCm38) critical splice donor site probably null
R7664:Lrp2 UTSW 2 69,506,732 (GRCm38) missense probably damaging 1.00
R7686:Lrp2 UTSW 2 69,489,237 (GRCm38) missense probably damaging 1.00
R7711:Lrp2 UTSW 2 69,479,343 (GRCm38) critical splice acceptor site probably null
R7737:Lrp2 UTSW 2 69,496,438 (GRCm38) missense possibly damaging 0.77
R7763:Lrp2 UTSW 2 69,503,388 (GRCm38) missense probably damaging 0.99
R7775:Lrp2 UTSW 2 69,501,539 (GRCm38) missense possibly damaging 0.74
R7824:Lrp2 UTSW 2 69,501,539 (GRCm38) missense possibly damaging 0.74
R7840:Lrp2 UTSW 2 69,464,784 (GRCm38) missense probably damaging 0.98
R7878:Lrp2 UTSW 2 69,507,809 (GRCm38) missense probably damaging 1.00
R7878:Lrp2 UTSW 2 69,507,810 (GRCm38) missense probably damaging 1.00
R7895:Lrp2 UTSW 2 69,458,479 (GRCm38) missense probably damaging 0.97
R7898:Lrp2 UTSW 2 69,441,366 (GRCm38) missense probably benign 0.00
R7912:Lrp2 UTSW 2 69,428,672 (GRCm38) missense probably benign 0.03
R7923:Lrp2 UTSW 2 69,438,388 (GRCm38) missense possibly damaging 0.75
R7932:Lrp2 UTSW 2 69,426,027 (GRCm38) missense probably benign 0.00
R7940:Lrp2 UTSW 2 69,432,197 (GRCm38) missense possibly damaging 0.91
R7954:Lrp2 UTSW 2 69,503,523 (GRCm38) missense possibly damaging 0.61
R8007:Lrp2 UTSW 2 69,506,505 (GRCm38) missense probably benign 0.02
R8084:Lrp2 UTSW 2 69,509,369 (GRCm38) missense probably damaging 0.97
R8087:Lrp2 UTSW 2 69,448,129 (GRCm38) missense probably damaging 1.00
R8090:Lrp2 UTSW 2 69,464,745 (GRCm38) missense possibly damaging 0.94
R8110:Lrp2 UTSW 2 69,506,453 (GRCm38) missense probably benign
R8129:Lrp2 UTSW 2 69,430,280 (GRCm38) missense possibly damaging 0.75
R8155:Lrp2 UTSW 2 69,482,998 (GRCm38) missense possibly damaging 0.74
R8182:Lrp2 UTSW 2 69,489,329 (GRCm38) missense probably damaging 1.00
R8239:Lrp2 UTSW 2 69,481,267 (GRCm38) nonsense probably null
R8247:Lrp2 UTSW 2 69,431,087 (GRCm38) missense possibly damaging 0.76
R8327:Lrp2 UTSW 2 69,491,924 (GRCm38) missense probably damaging 1.00
R8355:Lrp2 UTSW 2 69,516,484 (GRCm38) missense probably damaging 0.99
R8404:Lrp2 UTSW 2 69,514,241 (GRCm38) nonsense probably null
R8427:Lrp2 UTSW 2 69,451,297 (GRCm38) missense probably damaging 0.97
R8463:Lrp2 UTSW 2 69,491,906 (GRCm38) missense probably damaging 1.00
R8502:Lrp2 UTSW 2 69,514,241 (GRCm38) nonsense probably null
R8529:Lrp2 UTSW 2 69,500,642 (GRCm38) missense probably damaging 0.96
R8673:Lrp2 UTSW 2 69,472,460 (GRCm38) missense probably damaging 1.00
R8698:Lrp2 UTSW 2 69,458,423 (GRCm38) missense probably benign 0.37
R8698:Lrp2 UTSW 2 69,448,239 (GRCm38) missense probably benign 0.39
R8708:Lrp2 UTSW 2 69,459,613 (GRCm38) missense probably damaging 1.00
R8716:Lrp2 UTSW 2 69,443,794 (GRCm38) missense probably benign 0.04
R8723:Lrp2 UTSW 2 69,486,304 (GRCm38) missense probably damaging 1.00
R8787:Lrp2 UTSW 2 69,552,401 (GRCm38) missense probably damaging 1.00
R8903:Lrp2 UTSW 2 69,549,038 (GRCm38) missense possibly damaging 0.68
R8944:Lrp2 UTSW 2 69,511,004 (GRCm38) missense probably damaging 1.00
R9069:Lrp2 UTSW 2 69,501,652 (GRCm38) missense probably damaging 1.00
R9076:Lrp2 UTSW 2 69,519,916 (GRCm38) missense probably benign 0.01
R9155:Lrp2 UTSW 2 69,461,369 (GRCm38) nonsense probably null
R9173:Lrp2 UTSW 2 69,469,387 (GRCm38) missense probably damaging 1.00
R9254:Lrp2 UTSW 2 69,503,547 (GRCm38) missense probably benign 0.09
R9256:Lrp2 UTSW 2 69,510,959 (GRCm38) missense probably benign 0.03
R9291:Lrp2 UTSW 2 69,480,035 (GRCm38) missense probably damaging 1.00
R9335:Lrp2 UTSW 2 69,428,639 (GRCm38) missense probably benign 0.01
R9357:Lrp2 UTSW 2 69,506,573 (GRCm38) missense probably damaging 0.99
R9368:Lrp2 UTSW 2 69,527,635 (GRCm38) missense probably damaging 0.99
R9453:Lrp2 UTSW 2 69,458,488 (GRCm38) missense probably damaging 1.00
R9546:Lrp2 UTSW 2 69,456,821 (GRCm38) critical splice donor site probably null
R9554:Lrp2 UTSW 2 69,431,153 (GRCm38) missense probably damaging 1.00
R9597:Lrp2 UTSW 2 69,430,359 (GRCm38) missense probably benign 0.02
R9601:Lrp2 UTSW 2 69,459,584 (GRCm38) missense probably damaging 1.00
R9623:Lrp2 UTSW 2 69,477,079 (GRCm38) missense probably benign 0.09
RF016:Lrp2 UTSW 2 69,509,205 (GRCm38) missense probably benign
X0011:Lrp2 UTSW 2 69,519,998 (GRCm38) missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69,436,600 (GRCm38) missense probably damaging 0.99
Z1176:Lrp2 UTSW 2 69,507,881 (GRCm38) missense possibly damaging 0.88
Z1176:Lrp2 UTSW 2 69,480,042 (GRCm38) missense possibly damaging 0.66
Z1177:Lrp2 UTSW 2 69,496,468 (GRCm38) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,472,453 (GRCm38) missense probably benign 0.03
Z1177:Lrp2 UTSW 2 69,451,280 (GRCm38) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,509,289 (GRCm38) missense probably benign 0.00
Z1177:Lrp2 UTSW 2 69,501,641 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATAGGAATGTAGCACTGTCAG -3'
(R):5'- CCTCAGCCTGAGCCATGATATC -3'

Sequencing Primer
(F):5'- GCACTGTCAGGAATTATGTTGAAG -3'
(R):5'- TTAAATAAGGGCTTCCAAAGAGC -3'
Posted On 2014-10-15