Incidental Mutation 'R2248:Olfr1141'
ID240931
Institutional Source Beutler Lab
Gene Symbol Olfr1141
Ensembl Gene ENSMUSG00000075148
Gene Nameolfactory receptor 1141
SynonymsMOR177-10, GA_x6K02T2Q125-49257818-49256883
MMRRC Submission 040248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2248 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87753056-87753991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87753943 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 17 (I17V)
Ref Sequence ENSEMBL: ENSMUSP00000097433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099846]
Predicted Effect probably null
Transcript: ENSMUST00000099846
AA Change: I17V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097433
Gene: ENSMUSG00000075148
AA Change: I17V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.8e-28 PFAM
Pfam:7tm_1 41 290 1.5e-6 PFAM
Meta Mutation Damage Score 0.2175 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,114 T482A probably benign Het
Abca2 A G 2: 25,433,464 probably benign Het
Afp A G 5: 90,501,570 D332G probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aldh1a2 A T 9: 71,215,862 I6F possibly damaging Het
Alg6 C T 4: 99,738,207 A84V probably damaging Het
Ank T A 15: 27,562,711 probably null Het
Ano5 A T 7: 51,593,789 M837L probably benign Het
Arl8b A G 6: 108,783,343 Y30C probably benign Het
Bfsp1 A T 2: 143,827,652 probably null Het
Cdhr1 C G 14: 37,081,377 V581L probably benign Het
Chst8 G T 7: 34,748,172 T7K probably damaging Het
Clca3b T C 3: 144,825,219 K790R probably benign Het
Clta A G 4: 44,012,852 N21D probably damaging Het
Col6a4 T G 9: 106,079,959 E222A probably benign Het
Dcc G T 18: 71,826,168 Q178K probably benign Het
Dpysl3 T C 18: 43,358,293 D140G possibly damaging Het
Dthd1 A T 5: 62,849,900 D648V probably damaging Het
Eva1c A G 16: 90,831,325 N18S probably benign Het
Flnc A G 6: 29,451,401 H1538R probably damaging Het
Foxn3 T C 12: 99,196,556 E362G probably benign Het
Frk C A 10: 34,608,531 T500K probably benign Het
Glipr1l1 A G 10: 112,062,287 E99G probably benign Het
Gm6169 C A 13: 97,098,898 V114F possibly damaging Het
Gphn T C 12: 78,454,821 L120P probably damaging Het
Gpr152 T C 19: 4,143,806 S449P probably benign Het
Greb1 T A 12: 16,680,378 I1655F possibly damaging Het
Hectd1 G T 12: 51,806,471 T89N probably damaging Het
Helz2 A C 2: 181,233,433 I1756S probably benign Het
Hydin G T 8: 110,578,203 R3825L probably benign Het
Ifi207 G A 1: 173,736,470 probably benign Het
Itpr3 A T 17: 27,115,059 E2035V probably damaging Het
Khnyn T A 14: 55,886,738 S150T probably benign Het
Kif21b T C 1: 136,172,966 I1595T probably damaging Het
Lgsn A T 1: 31,203,526 T230S possibly damaging Het
Limch1 G T 5: 67,044,399 G838V probably damaging Het
Lrp2 T A 2: 69,511,010 D942V probably damaging Het
Lrrc31 T A 3: 30,689,901 T153S possibly damaging Het
Mal2 T A 15: 54,588,336 I51N probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mycbp2 T A 14: 103,169,859 Q385L possibly damaging Het
Nav3 T A 10: 109,696,227 D2117V probably damaging Het
Ntn1 T C 11: 68,277,572 N353S possibly damaging Het
Oas1c T C 5: 120,802,861 E289G possibly damaging Het
Olfr1254 C A 2: 89,789,180 M57I possibly damaging Het
Olfr165 A G 16: 19,407,194 V274A probably damaging Het
Plk1 A G 7: 122,168,821 probably benign Het
Pms2 G A 5: 143,916,506 V230M probably damaging Het
Pole3 C A 4: 62,525,013 probably benign Het
Ppp2r5c T C 12: 110,485,923 F22S probably benign Het
Ptcd3 A T 6: 71,894,285 probably null Het
Ptprq A T 10: 107,643,070 probably null Het
Rab18 T A 18: 6,788,629 C199S probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Sacs A G 14: 61,212,802 N4099S probably damaging Het
Sh3yl1 T A 12: 30,942,870 probably null Het
Slco1c1 T A 6: 141,546,689 I217N probably damaging Het
Syne2 C T 12: 76,096,904 T6241I probably damaging Het
Tas2r119 T C 15: 32,178,151 F288L possibly damaging Het
Tmod2 G T 9: 75,592,649 T107N probably benign Het
Trappc6b T C 12: 59,050,381 T52A probably damaging Het
Tsen54 A G 11: 115,815,406 E122G probably damaging Het
Tspear A G 10: 77,873,269 N443S probably damaging Het
Unc80 A G 1: 66,623,206 probably benign Het
Virma T A 4: 11,518,927 Y725N probably damaging Het
Vwa7 G A 17: 35,019,043 D207N probably benign Het
Other mutations in Olfr1141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr1141 APN 2 87753934 missense probably benign 0.00
IGL01412:Olfr1141 APN 2 87753117 missense probably damaging 1.00
IGL01533:Olfr1141 APN 2 87753068 missense probably benign 0.01
IGL02455:Olfr1141 APN 2 87753583 missense possibly damaging 0.95
IGL02698:Olfr1141 APN 2 87753844 nonsense probably null
PIT4480001:Olfr1141 UTSW 2 87753783 missense possibly damaging 0.95
R0543:Olfr1141 UTSW 2 87753650 missense probably damaging 1.00
R1542:Olfr1141 UTSW 2 87753318 missense probably damaging 0.99
R1750:Olfr1141 UTSW 2 87753186 missense probably damaging 0.97
R1844:Olfr1141 UTSW 2 87753990 start codon destroyed probably null 1.00
R4064:Olfr1141 UTSW 2 87753789 missense probably damaging 1.00
R5193:Olfr1141 UTSW 2 87753104 missense possibly damaging 0.59
R5861:Olfr1141 UTSW 2 87753578 missense probably benign 0.01
R6146:Olfr1141 UTSW 2 87753258 missense probably damaging 1.00
R6197:Olfr1141 UTSW 2 87753352 missense probably benign 0.15
R6481:Olfr1141 UTSW 2 87753468 missense probably damaging 1.00
R6857:Olfr1141 UTSW 2 87753487 missense probably damaging 1.00
R6904:Olfr1141 UTSW 2 87753879 missense probably benign 0.00
R6962:Olfr1141 UTSW 2 87753727 missense probably benign
R7014:Olfr1141 UTSW 2 87753871 missense probably benign 0.00
T0722:Olfr1141 UTSW 2 87753123 missense probably damaging 1.00
Z1177:Olfr1141 UTSW 2 87753190 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTTGGACCCAATTGCAGAG -3'
(R):5'- GCAAAACCGTTCAAGTTTCATCTTC -3'

Sequencing Primer
(F):5'- CCCAATTGCAGAGGAGTAGCTG -3'
(R):5'- ACCGTTCAAGTTTCATCTTCAACTTC -3'
Posted On2014-10-15