Incidental Mutation 'R2248:Virma'
ID240937
Institutional Source Beutler Lab
Gene Symbol Virma
Ensembl Gene ENSMUSG00000040720
Gene Namevir like m6A methyltransferase associated
Synonyms1110037F02Rik
MMRRC Submission 040248-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2248 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location11485958-11550684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11518927 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 725 (Y725N)
Ref Sequence ENSEMBL: ENSMUSP00000103943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055372] [ENSMUST00000059914] [ENSMUST00000108307]
Predicted Effect probably damaging
Transcript: ENSMUST00000055372
AA Change: Y675N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063188
Gene: ENSMUSG00000040720
AA Change: Y675N

DomainStartEndE-ValueType
low complexity region 139 153 N/A INTRINSIC
low complexity region 172 198 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000059914
AA Change: Y675N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058078
Gene: ENSMUSG00000040720
AA Change: Y675N

DomainStartEndE-ValueType
low complexity region 139 153 N/A INTRINSIC
low complexity region 172 198 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1224 1232 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
low complexity region 1460 1474 N/A INTRINSIC
low complexity region 1618 1634 N/A INTRINSIC
low complexity region 1684 1697 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
low complexity region 1796 1808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108307
AA Change: Y725N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103943
Gene: ENSMUSG00000040720
AA Change: Y725N

DomainStartEndE-ValueType
Pfam:VIR_N 5 266 2e-110 PFAM
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1058 1070 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1274 1282 N/A INTRINSIC
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1510 1524 N/A INTRINSIC
low complexity region 1668 1684 N/A INTRINSIC
low complexity region 1734 1747 N/A INTRINSIC
low complexity region 1800 1807 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Meta Mutation Damage Score 0.8885 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,114 T482A probably benign Het
Abca2 A G 2: 25,433,464 probably benign Het
Afp A G 5: 90,501,570 D332G probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aldh1a2 A T 9: 71,215,862 I6F possibly damaging Het
Alg6 C T 4: 99,738,207 A84V probably damaging Het
Ank T A 15: 27,562,711 probably null Het
Ano5 A T 7: 51,593,789 M837L probably benign Het
Arl8b A G 6: 108,783,343 Y30C probably benign Het
Bfsp1 A T 2: 143,827,652 probably null Het
Cdhr1 C G 14: 37,081,377 V581L probably benign Het
Chst8 G T 7: 34,748,172 T7K probably damaging Het
Clca3b T C 3: 144,825,219 K790R probably benign Het
Clta A G 4: 44,012,852 N21D probably damaging Het
Col6a4 T G 9: 106,079,959 E222A probably benign Het
Dcc G T 18: 71,826,168 Q178K probably benign Het
Dpysl3 T C 18: 43,358,293 D140G possibly damaging Het
Dthd1 A T 5: 62,849,900 D648V probably damaging Het
Eva1c A G 16: 90,831,325 N18S probably benign Het
Flnc A G 6: 29,451,401 H1538R probably damaging Het
Foxn3 T C 12: 99,196,556 E362G probably benign Het
Frk C A 10: 34,608,531 T500K probably benign Het
Glipr1l1 A G 10: 112,062,287 E99G probably benign Het
Gm6169 C A 13: 97,098,898 V114F possibly damaging Het
Gphn T C 12: 78,454,821 L120P probably damaging Het
Gpr152 T C 19: 4,143,806 S449P probably benign Het
Greb1 T A 12: 16,680,378 I1655F possibly damaging Het
Hectd1 G T 12: 51,806,471 T89N probably damaging Het
Helz2 A C 2: 181,233,433 I1756S probably benign Het
Hydin G T 8: 110,578,203 R3825L probably benign Het
Ifi207 G A 1: 173,736,470 probably benign Het
Itpr3 A T 17: 27,115,059 E2035V probably damaging Het
Khnyn T A 14: 55,886,738 S150T probably benign Het
Kif21b T C 1: 136,172,966 I1595T probably damaging Het
Lgsn A T 1: 31,203,526 T230S possibly damaging Het
Limch1 G T 5: 67,044,399 G838V probably damaging Het
Lrp2 T A 2: 69,511,010 D942V probably damaging Het
Lrrc31 T A 3: 30,689,901 T153S possibly damaging Het
Mal2 T A 15: 54,588,336 I51N probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mycbp2 T A 14: 103,169,859 Q385L possibly damaging Het
Nav3 T A 10: 109,696,227 D2117V probably damaging Het
Ntn1 T C 11: 68,277,572 N353S possibly damaging Het
Oas1c T C 5: 120,802,861 E289G possibly damaging Het
Olfr1141 T C 2: 87,753,943 I17V probably null Het
Olfr1254 C A 2: 89,789,180 M57I possibly damaging Het
Olfr165 A G 16: 19,407,194 V274A probably damaging Het
Plk1 A G 7: 122,168,821 probably benign Het
Pms2 G A 5: 143,916,506 V230M probably damaging Het
Pole3 C A 4: 62,525,013 probably benign Het
Ppp2r5c T C 12: 110,485,923 F22S probably benign Het
Ptcd3 A T 6: 71,894,285 probably null Het
Ptprq A T 10: 107,643,070 probably null Het
Rab18 T A 18: 6,788,629 C199S probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Sacs A G 14: 61,212,802 N4099S probably damaging Het
Sh3yl1 T A 12: 30,942,870 probably null Het
Slco1c1 T A 6: 141,546,689 I217N probably damaging Het
Syne2 C T 12: 76,096,904 T6241I probably damaging Het
Tas2r119 T C 15: 32,178,151 F288L possibly damaging Het
Tmod2 G T 9: 75,592,649 T107N probably benign Het
Trappc6b T C 12: 59,050,381 T52A probably damaging Het
Tsen54 A G 11: 115,815,406 E122G probably damaging Het
Tspear A G 10: 77,873,269 N443S probably damaging Het
Unc80 A G 1: 66,623,206 probably benign Het
Vwa7 G A 17: 35,019,043 D207N probably benign Het
Other mutations in Virma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Virma APN 4 11519424 splice site probably benign
IGL00477:Virma APN 4 11519006 missense probably damaging 0.99
IGL01293:Virma APN 4 11521114 missense probably damaging 1.00
IGL01410:Virma APN 4 11518929 nonsense probably null
IGL01531:Virma APN 4 11528753 missense probably damaging 1.00
IGL01672:Virma APN 4 11527792 missense probably damaging 1.00
IGL01724:Virma APN 4 11528672 missense probably damaging 1.00
IGL01747:Virma APN 4 11526877 missense probably damaging 1.00
IGL01776:Virma APN 4 11527792 missense probably damaging 1.00
IGL02064:Virma APN 4 11513163 missense possibly damaging 0.87
IGL02243:Virma APN 4 11546031 missense probably damaging 1.00
IGL02244:Virma APN 4 11546031 missense probably damaging 1.00
IGL02445:Virma APN 4 11527029 missense probably damaging 0.97
IGL02546:Virma APN 4 11494804 missense probably damaging 0.99
IGL02807:Virma APN 4 11507079 splice site probably benign
IGL02967:Virma APN 4 11514096 missense probably benign 0.01
IGL03211:Virma APN 4 11548770 nonsense probably null
IGL03242:Virma APN 4 11527669 missense possibly damaging 0.70
IGL03256:Virma APN 4 11542207 splice site probably benign
IGL03327:Virma APN 4 11518984 missense probably benign 0.00
IGL03346:Virma APN 4 11518984 missense probably benign 0.00
PIT4802001:Virma UTSW 4 11546008 missense probably damaging 0.99
R0142:Virma UTSW 4 11548783 missense probably benign 0.04
R0355:Virma UTSW 4 11528626 nonsense probably null
R0522:Virma UTSW 4 11519416 critical splice donor site probably null
R0600:Virma UTSW 4 11498769 missense probably damaging 0.99
R1435:Virma UTSW 4 11528621 missense probably damaging 1.00
R1489:Virma UTSW 4 11521164 missense probably damaging 1.00
R1568:Virma UTSW 4 11528776 missense probably damaging 0.99
R1616:Virma UTSW 4 11544954 missense probably damaging 1.00
R1655:Virma UTSW 4 11494786 missense probably damaging 1.00
R1695:Virma UTSW 4 11494814 missense probably damaging 0.98
R1835:Virma UTSW 4 11540511 missense probably benign 0.02
R1951:Virma UTSW 4 11513907 missense probably benign 0.00
R1991:Virma UTSW 4 11519242 missense probably benign 0.06
R2145:Virma UTSW 4 11548726 splice site probably benign
R2172:Virma UTSW 4 11527843 missense possibly damaging 0.82
R2217:Virma UTSW 4 11544924 missense probably damaging 1.00
R2218:Virma UTSW 4 11544924 missense probably damaging 1.00
R2342:Virma UTSW 4 11501316 missense probably damaging 1.00
R3424:Virma UTSW 4 11513177 nonsense probably null
R4397:Virma UTSW 4 11513901 missense possibly damaging 0.81
R4449:Virma UTSW 4 11498828 critical splice donor site probably null
R4660:Virma UTSW 4 11513505 missense probably damaging 1.00
R4698:Virma UTSW 4 11528636 missense probably damaging 0.99
R4878:Virma UTSW 4 11544971 missense probably damaging 1.00
R4937:Virma UTSW 4 11521147 nonsense probably null
R5031:Virma UTSW 4 11542116 nonsense probably null
R5040:Virma UTSW 4 11528746 missense probably benign 0.01
R5061:Virma UTSW 4 11494840 missense possibly damaging 0.95
R5091:Virma UTSW 4 11519392 missense probably benign 0.00
R5137:Virma UTSW 4 11546297 missense probably damaging 1.00
R5262:Virma UTSW 4 11539926 missense probably benign 0.01
R5297:Virma UTSW 4 11494819 missense probably damaging 1.00
R5730:Virma UTSW 4 11542154 missense probably benign 0.44
R5818:Virma UTSW 4 11513319 missense possibly damaging 0.92
R5835:Virma UTSW 4 11514036 missense probably damaging 1.00
R6125:Virma UTSW 4 11521172 missense probably damaging 0.98
R6197:Virma UTSW 4 11505498 missense probably damaging 0.96
R6222:Virma UTSW 4 11527820 missense probably damaging 1.00
R6793:Virma UTSW 4 11539968 missense probably damaging 1.00
R7028:Virma UTSW 4 11519249 missense possibly damaging 0.50
R7356:Virma UTSW 4 11513595 missense probably damaging 0.99
R7383:Virma UTSW 4 11514026 missense probably damaging 0.98
R7391:Virma UTSW 4 11508099 missense probably damaging 0.99
R7425:Virma UTSW 4 11546211 missense possibly damaging 0.95
R7556:Virma UTSW 4 11518927 missense probably damaging 1.00
R7715:Virma UTSW 4 11549682 missense probably damaging 1.00
R7715:Virma UTSW 4 11513016 splice site probably null
R8048:Virma UTSW 4 11539918 nonsense probably null
R8050:Virma UTSW 4 11528643 missense probably benign 0.22
X0020:Virma UTSW 4 11486055 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACAGAAAAGAGTTGGTGC -3'
(R):5'- AGGCAAAGGCATCATCAGCC -3'

Sequencing Primer
(F):5'- AAAGAGTTGGTGCTCACATTG -3'
(R):5'- CAGAGCTCGGATCAACAAGTTTGTC -3'
Posted On2014-10-15