Incidental Mutation 'R2248:Clta'
ID240938
Institutional Source Beutler Lab
Gene Symbol Clta
Ensembl Gene ENSMUSG00000028478
Gene Nameclathrin, light polypeptide (Lca)
Synonyms
MMRRC Submission 040248-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R2248 (G1)
Quality Score192
Status Validated
Chromosome4
Chromosomal Location44004452-44032846 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44012852 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 21 (N21D)
Ref Sequence ENSEMBL: ENSMUSP00000103483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107845] [ENSMUST00000107846] [ENSMUST00000107847] [ENSMUST00000107849] [ENSMUST00000107851] [ENSMUST00000170241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107845
AA Change: N21D

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103477
Gene: ENSMUSG00000028478
AA Change: N21D

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 3 215 1.4e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107846
AA Change: N21D

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103478
Gene: ENSMUSG00000028478
AA Change: N21D

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 3 217 1.1e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107847
AA Change: N21D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103479
Gene: ENSMUSG00000028478
AA Change: N21D

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 3 229 2e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107849
AA Change: N21D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103481
Gene: ENSMUSG00000028478
AA Change: N21D

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 3 235 3.5e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107851
AA Change: N21D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103483
Gene: ENSMUSG00000028478
AA Change: N21D

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 15 247 4.1e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170241
AA Change: N21D

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127344
Gene: ENSMUSG00000028478
AA Change: N21D

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 3 217 1.1e-73 PFAM
Meta Mutation Damage Score 0.2122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Clathrin is a large, soluble protein composed of heavy and light chains. It functions as the main structural component of the lattice-type cytoplasmic face of coated pits and vesicles which entrap specific macromolecules during receptor-mediated endocytosis. This gene encodes one of two clathrin light chain proteins which are believed to function as regulatory elements. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,114 T482A probably benign Het
Abca2 A G 2: 25,433,464 probably benign Het
Afp A G 5: 90,501,570 D332G probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aldh1a2 A T 9: 71,215,862 I6F possibly damaging Het
Alg6 C T 4: 99,738,207 A84V probably damaging Het
Ank T A 15: 27,562,711 probably null Het
Ano5 A T 7: 51,593,789 M837L probably benign Het
Arl8b A G 6: 108,783,343 Y30C probably benign Het
Bfsp1 A T 2: 143,827,652 probably null Het
Cdhr1 C G 14: 37,081,377 V581L probably benign Het
Chst8 G T 7: 34,748,172 T7K probably damaging Het
Clca3b T C 3: 144,825,219 K790R probably benign Het
Col6a4 T G 9: 106,079,959 E222A probably benign Het
Dcc G T 18: 71,826,168 Q178K probably benign Het
Dpysl3 T C 18: 43,358,293 D140G possibly damaging Het
Dthd1 A T 5: 62,849,900 D648V probably damaging Het
Eva1c A G 16: 90,831,325 N18S probably benign Het
Flnc A G 6: 29,451,401 H1538R probably damaging Het
Foxn3 T C 12: 99,196,556 E362G probably benign Het
Frk C A 10: 34,608,531 T500K probably benign Het
Glipr1l1 A G 10: 112,062,287 E99G probably benign Het
Gm6169 C A 13: 97,098,898 V114F possibly damaging Het
Gphn T C 12: 78,454,821 L120P probably damaging Het
Gpr152 T C 19: 4,143,806 S449P probably benign Het
Greb1 T A 12: 16,680,378 I1655F possibly damaging Het
Hectd1 G T 12: 51,806,471 T89N probably damaging Het
Helz2 A C 2: 181,233,433 I1756S probably benign Het
Hydin G T 8: 110,578,203 R3825L probably benign Het
Ifi207 G A 1: 173,736,470 probably benign Het
Itpr3 A T 17: 27,115,059 E2035V probably damaging Het
Khnyn T A 14: 55,886,738 S150T probably benign Het
Kif21b T C 1: 136,172,966 I1595T probably damaging Het
Lgsn A T 1: 31,203,526 T230S possibly damaging Het
Limch1 G T 5: 67,044,399 G838V probably damaging Het
Lrp2 T A 2: 69,511,010 D942V probably damaging Het
Lrrc31 T A 3: 30,689,901 T153S possibly damaging Het
Mal2 T A 15: 54,588,336 I51N probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mycbp2 T A 14: 103,169,859 Q385L possibly damaging Het
Nav3 T A 10: 109,696,227 D2117V probably damaging Het
Ntn1 T C 11: 68,277,572 N353S possibly damaging Het
Oas1c T C 5: 120,802,861 E289G possibly damaging Het
Olfr1141 T C 2: 87,753,943 I17V probably null Het
Olfr1254 C A 2: 89,789,180 M57I possibly damaging Het
Olfr165 A G 16: 19,407,194 V274A probably damaging Het
Plk1 A G 7: 122,168,821 probably benign Het
Pms2 G A 5: 143,916,506 V230M probably damaging Het
Pole3 C A 4: 62,525,013 probably benign Het
Ppp2r5c T C 12: 110,485,923 F22S probably benign Het
Ptcd3 A T 6: 71,894,285 probably null Het
Ptprq A T 10: 107,643,070 probably null Het
Rab18 T A 18: 6,788,629 C199S probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Sacs A G 14: 61,212,802 N4099S probably damaging Het
Sh3yl1 T A 12: 30,942,870 probably null Het
Slco1c1 T A 6: 141,546,689 I217N probably damaging Het
Syne2 C T 12: 76,096,904 T6241I probably damaging Het
Tas2r119 T C 15: 32,178,151 F288L possibly damaging Het
Tmod2 G T 9: 75,592,649 T107N probably benign Het
Trappc6b T C 12: 59,050,381 T52A probably damaging Het
Tsen54 A G 11: 115,815,406 E122G probably damaging Het
Tspear A G 10: 77,873,269 N443S probably damaging Het
Unc80 A G 1: 66,623,206 probably benign Het
Virma T A 4: 11,518,927 Y725N probably damaging Het
Vwa7 G A 17: 35,019,043 D207N probably benign Het
Other mutations in Clta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02078:Clta APN 4 44030232 missense probably damaging 1.00
IGL02414:Clta APN 4 44030274 intron probably benign
IGL03184:Clta APN 4 44025514 missense probably benign 0.12
R0129:Clta UTSW 4 44032424 missense probably benign 0.02
R4489:Clta UTSW 4 44032417 missense probably damaging 0.99
R4599:Clta UTSW 4 44012819 missense probably damaging 1.00
R7432:Clta UTSW 4 44032419 missense possibly damaging 0.79
R7649:Clta UTSW 4 44025494 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GATATAGAAGCAGGGTTTCCGC -3'
(R):5'- AAGTTCCGCGTAAGAGCAC -3'

Sequencing Primer
(F):5'- GCAGGGTTTCCGCTTCCAC -3'
(R):5'- AGTGTGCCCACAAGTCCTC -3'
Posted On2014-10-15