Mutagenetix > Incidental Mutations

Incidental Mutation 'R0165:Adgrl2'

24094

Institutional Source

Beutler Lab

Gene Symbol

Adgrl2

Ensembl Gene

ENSMUSG00000028184

Gene Name

adhesion G protein-coupled receptor L2

Synonyms

Lec1, Lphn2, Lphh1

MMRRC Submission

038441-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148815583-148990555 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 148852863 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]

Predicted Effect

probably benign
Transcript: ENSMUST00000106128

SMART Domains

Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	2.5e-26	PFAM
OLF	142	398	5.22e-140	SMART
HormR	469	534	3.14e-20	SMART
Pfam:GAIN	537	764	1.3e-58	PFAM
GPS	788	840	3.47e-25	SMART
Pfam:7tm_2	848	1108	4.6e-69	PFAM
Pfam:Latrophilin	1128	1487	6.4e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195988

SMART Domains

Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.3e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.1e-66	PFAM
Pfam:Latrophilin	1119	1189	2.2e-28	PFAM
Pfam:Latrophilin	1184	1435	5.5e-123	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196526

SMART Domains

Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	8.7e-24	PFAM
OLF	138	394	3.4e-142	SMART
HormR	465	530	2e-22	SMART
Pfam:GAIN	533	747	1.1e-54	PFAM
GPS	771	823	2.2e-27	SMART
Pfam:7tm_2	831	1067	6.5e-68	PFAM
Pfam:Latrophilin	1087	1158	9.9e-36	PFAM
low complexity region	1163	1173	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197567

SMART Domains

Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	1.9e-26	PFAM
OLF	142	398	5.22e-140	SMART
HormR	469	534	3.14e-20	SMART
Pfam:GAIN	537	764	1.1e-58	PFAM
GPS	788	840	3.47e-25	SMART
Pfam:7tm_2	848	1108	6.4e-69	PFAM
Pfam:Latrophilin	1128	1487	2.8e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198779

SMART Domains

Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1084	1.8e-66	PFAM
Pfam:Latrophilin	1104	1452	7e-174	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199059

SMART Domains

Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.3e-66	PFAM
Pfam:Latrophilin	1119	1467	7.1e-174	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199238

SMART Domains

Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.4e-66	PFAM
Pfam:Latrophilin	1119	1478	1.6e-187	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199750

SMART Domains

Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.1e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	403	468	1.9e-22	SMART
GPS	709	761	2.1e-27	SMART
Pfam:7tm_2	769	1005	1.6e-66	PFAM
Pfam:Latrophilin	1025	1095	2e-28	PFAM
Pfam:Latrophilin	1090	1341	4.9e-123	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200154

SMART Domains

Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	2.5e-23	PFAM
OLF	138	394	3.3e-142	SMART
HormR	465	530	2e-22	SMART
GPS	771	823	2.1e-27	SMART
Pfam:7tm_2	831	1067	1.2e-66	PFAM
Pfam:Latrophilin	1087	1123	2.2e-4	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200543

SMART Domains

Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.2e-23	PFAM
OLF	138	394	3.3e-142	SMART
HormR	465	530	2e-22	SMART
GPS	771	823	2.1e-27	SMART
Pfam:7tm_2	831	1067	1.7e-66	PFAM
Pfam:Latrophilin	1087	1157	2.1e-28	PFAM
Pfam:Latrophilin	1152	1403	5.3e-123	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.2%
20x: 91.4%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,216,382	V1413M	probably damaging	Het
2700049A03Rik	T	C	12: 71,167,150	I717T	possibly damaging	Het
3632451O06Rik	A	G	14: 49,773,786	S155P	probably benign	Het
6430571L13Rik	A	G	9: 107,346,184		probably benign	Het
Abca15	T	A	7: 120,350,903		probably benign	Het
Abca6	A	G	11: 110,219,604	V573A	possibly damaging	Het
Agap3	A	G	5: 24,479,745	T544A	probably damaging	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Akr1c20	T	C	13: 4,523,296	T7A	probably benign	Het
Ankrd26	A	G	6: 118,540,484	S459P	probably benign	Het
Ascc3	T	A	10: 50,842,127		probably null	Het
Brd1	T	C	15: 88,729,777	N305S	probably damaging	Het
Catip	T	A	1: 74,368,469	L320Q	possibly damaging	Het
Cttnbp2	G	A	6: 18,435,410	Q150*	probably null	Het
Cyp2d22	T	G	15: 82,373,280	N228T	probably benign	Het
Dapk1	T	C	13: 60,761,593	V1340A	probably benign	Het
Dcaf4	G	A	12: 83,535,988		probably benign	Het
Ddhd1	G	A	14: 45,595,592	T849M	probably damaging	Het
Dnah6	A	G	6: 73,021,323	S3987P	probably benign	Het
Dst	C	A	1: 34,154,646		probably benign	Het
Epha2	T	C	4: 141,321,892		probably null	Het
Ern2	T	C	7: 122,179,779	T281A	probably benign	Het
Extl1	A	G	4: 134,357,703	F652S	probably damaging	Het
Gckr	A	G	5: 31,326,948	S541G	possibly damaging	Het
Gdap1l1	A	G	2: 163,451,499		probably null	Het
Gm7535	T	C	17: 17,911,175		probably benign	Het
Gmps	T	A	3: 63,993,954	I398N	probably damaging	Het
Igf2r	A	G	17: 12,698,527	V1556A	probably benign	Het
Il3ra	T	A	14: 14,350,967	N283K	probably benign	Het
Ist1	A	G	8: 109,675,366		probably benign	Het
Lama3	A	T	18: 12,524,810	I1934F	probably damaging	Het
Lars	A	T	18: 42,202,697	M1118K	possibly damaging	Het
Lpin2	C	T	17: 71,246,519	S846L	probably damaging	Het
Lrrc4b	C	A	7: 44,462,315	T537K	probably damaging	Het
Ltn1	G	A	16: 87,405,519		probably benign	Het
Meiob	A	G	17: 24,835,161	T401A	probably benign	Het
Mettl21e	G	A	1: 44,211,123	T41M	probably damaging	Het
Miga1	C	T	3: 152,290,843	E323K	probably damaging	Het
Ndufs1	A	T	1: 63,159,748		probably null	Het
Olfr486	T	C	7: 108,172,675	D23G	probably benign	Het
Otog	G	A	7: 46,304,231	V2638M	probably damaging	Het
Parp6	T	C	9: 59,632,925	Y274H	probably damaging	Het
Prom2	A	T	2: 127,539,514		probably benign	Het
Prune2	T	A	19: 17,122,610	M1826K	probably benign	Het
Qk	T	A	17: 10,238,963	D159V	probably damaging	Het
Rab12	A	T	17: 66,500,317	I139N	probably damaging	Het
Rab25	T	A	3: 88,548,055	E7D	probably benign	Het
Rala	A	T	13: 17,888,589	V139E	probably benign	Het
Ralgapa2	A	G	2: 146,388,487		probably benign	Het
Rbl2	T	A	8: 91,074,176	Y89N	probably damaging	Het
Rho	A	T	6: 115,932,227	I75F	probably damaging	Het
Slc38a4	C	A	15: 97,008,949	A303S	probably benign	Het
Slc6a15	A	G	10: 103,409,809	D551G	probably null	Het
Smyd3	T	C	1: 179,043,872	N314S	probably benign	Het
Speer4f1	T	A	5: 17,479,514	L180*	probably null	Het
Stat6	T	C	10: 127,657,227	V576A	probably damaging	Het
Strn	T	C	17: 78,677,374	D127G	possibly damaging	Het
Syne1	T	C	10: 5,033,096	R8610G	probably benign	Het
Tbc1d7	A	C	13: 43,153,202		probably null	Het
Tcf3	C	T	10: 80,412,997	R548Q	probably damaging	Het
Tlr9	C	A	9: 106,226,087	A859D	probably benign	Het
Tmem106c	T	A	15: 97,968,139		probably benign	Het
Tmprss11c	A	T	5: 86,231,927		probably benign	Het
Tnfsf18	A	G	1: 161,494,731	R7G	probably benign	Het
Tnrc6b	T	A	15: 80,858,670		probably null	Het
Trpm7	A	T	2: 126,797,513	F1684I	probably damaging	Het
Ttbk1	C	A	17: 46,478,938	R133L	possibly damaging	Het
Ttn	A	G	2: 76,721,342	S22962P	probably damaging	Het
Ube2q1	T	A	3: 89,776,153	L135Q	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vwce	T	C	19: 10,659,973		probably benign	Het
Wdhd1	A	G	14: 47,267,068	S350P	probably benign	Het
Zbtb21	A	G	16: 97,951,404	S560P	probably damaging	Het

Other mutations in Adgrl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Adgrl2	APN	3	148865608	missense	probably damaging	0.99
IGL00572:Adgrl2	APN	3	148826498	missense	probably damaging	1.00
IGL01624:Adgrl2	APN	3	148836527	missense	probably damaging	1.00
IGL01796:Adgrl2	APN	3	148858975	missense	probably damaging	1.00
IGL02380:Adgrl2	APN	3	148828489	nonsense	probably null
IGL02468:Adgrl2	APN	3	148890480	missense	probably damaging	1.00
IGL02708:Adgrl2	APN	3	148826525	missense	probably damaging	0.96
IGL02869:Adgrl2	APN	3	148890605	missense	probably damaging	1.00
IGL03248:Adgrl2	APN	3	148817400	missense	probably damaging	1.00
IGL03343:Adgrl2	APN	3	148859380	missense	probably damaging	0.98
P0157:Adgrl2	UTSW	3	148859063	missense	probably damaging	1.00
PIT4382001:Adgrl2	UTSW	3	148817298	missense
PIT4544001:Adgrl2	UTSW	3	148890521	missense	probably damaging	1.00
R0242:Adgrl2	UTSW	3	148839185	unclassified	probably null
R0242:Adgrl2	UTSW	3	148839185	unclassified	probably null
R0344:Adgrl2	UTSW	3	148865595	splice site	probably null
R0488:Adgrl2	UTSW	3	148846905	missense	probably damaging	1.00
R0542:Adgrl2	UTSW	3	148859218	missense	probably damaging	1.00
R0630:Adgrl2	UTSW	3	148839244	missense	probably damaging	0.98
R0674:Adgrl2	UTSW	3	148837679	missense	possibly damaging	0.91
R1401:Adgrl2	UTSW	3	148822981	missense	probably damaging	0.99
R1543:Adgrl2	UTSW	3	148859273	missense	probably damaging	1.00
R1575:Adgrl2	UTSW	3	148852762	missense	probably benign	0.17
R1645:Adgrl2	UTSW	3	148865608	missense	probably damaging	1.00
R1780:Adgrl2	UTSW	3	148852593	missense	probably damaging	1.00
R1992:Adgrl2	UTSW	3	148817244	missense	possibly damaging	0.89
R2014:Adgrl2	UTSW	3	148826475	missense	probably damaging	1.00
R2130:Adgrl2	UTSW	3	148890488	missense	probably damaging	0.99
R2131:Adgrl2	UTSW	3	148890488	missense	probably damaging	0.99
R2400:Adgrl2	UTSW	3	148851934	missense	probably damaging	1.00
R2997:Adgrl2	UTSW	3	148817649	missense	probably damaging	1.00
R3161:Adgrl2	UTSW	3	148817551	missense	probably damaging	1.00
R3416:Adgrl2	UTSW	3	148859329	missense	probably damaging	1.00
R3417:Adgrl2	UTSW	3	148859329	missense	probably damaging	1.00
R3551:Adgrl2	UTSW	3	148858963	missense	probably damaging	1.00
R3760:Adgrl2	UTSW	3	148817235	missense	probably damaging	1.00
R4355:Adgrl2	UTSW	3	148839152	missense	probably damaging	1.00
R4850:Adgrl2	UTSW	3	148859020	missense	probably damaging	1.00
R4911:Adgrl2	UTSW	3	148890463	missense	probably damaging	0.99
R4945:Adgrl2	UTSW	3	148823036	missense	probably damaging	0.99
R5313:Adgrl2	UTSW	3	148823713	missense	probably damaging	1.00
R5339:Adgrl2	UTSW	3	148817844	missense	probably benign	0.01
R5540:Adgrl2	UTSW	3	148837562	critical splice donor site	probably null
R5583:Adgrl2	UTSW	3	148859164	missense	probably damaging	1.00
R5890:Adgrl2	UTSW	3	148859175	missense	probably damaging	1.00
R6170:Adgrl2	UTSW	3	148823009	missense	probably damaging	1.00
R6197:Adgrl2	UTSW	3	148858942	missense	probably damaging	1.00
R6284:Adgrl2	UTSW	3	148826507	missense	probably damaging	1.00
R6877:Adgrl2	UTSW	3	148817286	missense	probably damaging	1.00
R7048:Adgrl2	UTSW	3	148846929	missense	probably damaging	1.00
R7205:Adgrl2	UTSW	3	148858949	missense	probably damaging	1.00
R7326:Adgrl2	UTSW	3	148846870	missense	probably benign	0.00
R7348:Adgrl2	UTSW	3	148817766	missense
R7382:Adgrl2	UTSW	3	148817283	missense
R7486:Adgrl2	UTSW	3	148817694	missense
R7498:Adgrl2	UTSW	3	148859216	nonsense	probably null
R7644:Adgrl2	UTSW	3	148839153	missense	probably damaging	1.00
R7690:Adgrl2	UTSW	3	148817298	missense
R7742:Adgrl2	UTSW	3	148836428	missense	probably damaging	1.00
R7745:Adgrl2	UTSW	3	148836458	missense	probably damaging	1.00
RF007:Adgrl2	UTSW	3	148839248	missense	probably damaging	1.00
X0009:Adgrl2	UTSW	3	148852654	missense	probably damaging	1.00
X0019:Adgrl2	UTSW	3	148865594	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAGTCTAACGCTTCGCAGAATC -3'
(R):5'- GACCATATTGCACCGAGATCCAGG -3'

Sequencing Primer
(F):5'- TCGCAGAATCTCTCTGGCAG -3'
(R):5'- CGAGATCCAGGATCACCTTTTAG -3'

Posted On

2013-04-16