Incidental Mutation 'R2248:Plk1'
ID240952
Institutional Source Beutler Lab
Gene Symbol Plk1
Ensembl Gene ENSMUSG00000030867
Gene Namepolo like kinase 1
SynonymsPlk, STPK13
MMRRC Submission 040248-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2248 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location122159439-122169873 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 122168821 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000033154] [ENSMUST00000206198] [ENSMUST00000206470]
Predicted Effect probably benign
Transcript: ENSMUST00000033153
SMART Domains Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
PQQ 33 64 5.5e-8 SMART
PQQ 115 147 4.7e-4 SMART
PQQ 148 180 6.1e-2 SMART
PQQ 192 223 6.2e-3 SMART
low complexity region 449 461 N/A INTRINSIC
S_TKc 508 768 2.5e-11 SMART
PUG 831 888 9e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033154
SMART Domains Protein: ENSMUSP00000033154
Gene: ENSMUSG00000030867

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 20 35 N/A INTRINSIC
S_TKc 53 305 7.36e-95 SMART
low complexity region 354 365 N/A INTRINSIC
Pfam:POLO_box 418 479 4.4e-24 PFAM
Pfam:POLO_box 516 583 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206202
Predicted Effect probably benign
Transcript: ENSMUST00000206470
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: The Ser/Thr protein kinase encoded by this gene belongs to the CDC5/Polo subfamily. It is highly expressed during mitosis and may play a role in DNA replication during S phase. This gene is expressed in all embryonic tissues, but restricted to thymus and ovaries in adult tissues. Homozygous knockout mice were embryonic lethal, suggesting that this gene is important for early embryonic development. This gene is thought to be a potential oncogene because it is overexpressed in a variety of tumors and tumor cell lines. Depletion of this protein in cancer cells has been shown to inhibit cell proliferation and suppress oncogenic transformation; hence, it is a target for cancer therapy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display lethality before implantation, embryonic growth arrest, and impaired mitosis. Mice heterozygous for a null mutation display increased tumor incidence and increased incidence of aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,114 T482A probably benign Het
Abca2 A G 2: 25,433,464 probably benign Het
Afp A G 5: 90,501,570 D332G probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aldh1a2 A T 9: 71,215,862 I6F possibly damaging Het
Alg6 C T 4: 99,738,207 A84V probably damaging Het
Ank T A 15: 27,562,711 probably null Het
Ano5 A T 7: 51,593,789 M837L probably benign Het
Arl8b A G 6: 108,783,343 Y30C probably benign Het
Bfsp1 A T 2: 143,827,652 probably null Het
Cdhr1 C G 14: 37,081,377 V581L probably benign Het
Chst8 G T 7: 34,748,172 T7K probably damaging Het
Clca3b T C 3: 144,825,219 K790R probably benign Het
Clta A G 4: 44,012,852 N21D probably damaging Het
Col6a4 T G 9: 106,079,959 E222A probably benign Het
Dcc G T 18: 71,826,168 Q178K probably benign Het
Dpysl3 T C 18: 43,358,293 D140G possibly damaging Het
Dthd1 A T 5: 62,849,900 D648V probably damaging Het
Eva1c A G 16: 90,831,325 N18S probably benign Het
Flnc A G 6: 29,451,401 H1538R probably damaging Het
Foxn3 T C 12: 99,196,556 E362G probably benign Het
Frk C A 10: 34,608,531 T500K probably benign Het
Glipr1l1 A G 10: 112,062,287 E99G probably benign Het
Gm6169 C A 13: 97,098,898 V114F possibly damaging Het
Gphn T C 12: 78,454,821 L120P probably damaging Het
Gpr152 T C 19: 4,143,806 S449P probably benign Het
Greb1 T A 12: 16,680,378 I1655F possibly damaging Het
Hectd1 G T 12: 51,806,471 T89N probably damaging Het
Helz2 A C 2: 181,233,433 I1756S probably benign Het
Hydin G T 8: 110,578,203 R3825L probably benign Het
Ifi207 G A 1: 173,736,470 probably benign Het
Itpr3 A T 17: 27,115,059 E2035V probably damaging Het
Khnyn T A 14: 55,886,738 S150T probably benign Het
Kif21b T C 1: 136,172,966 I1595T probably damaging Het
Lgsn A T 1: 31,203,526 T230S possibly damaging Het
Limch1 G T 5: 67,044,399 G838V probably damaging Het
Lrp2 T A 2: 69,511,010 D942V probably damaging Het
Lrrc31 T A 3: 30,689,901 T153S possibly damaging Het
Mal2 T A 15: 54,588,336 I51N probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mycbp2 T A 14: 103,169,859 Q385L possibly damaging Het
Nav3 T A 10: 109,696,227 D2117V probably damaging Het
Ntn1 T C 11: 68,277,572 N353S possibly damaging Het
Oas1c T C 5: 120,802,861 E289G possibly damaging Het
Olfr1141 T C 2: 87,753,943 I17V probably null Het
Olfr1254 C A 2: 89,789,180 M57I possibly damaging Het
Olfr165 A G 16: 19,407,194 V274A probably damaging Het
Pms2 G A 5: 143,916,506 V230M probably damaging Het
Pole3 C A 4: 62,525,013 probably benign Het
Ppp2r5c T C 12: 110,485,923 F22S probably benign Het
Ptcd3 A T 6: 71,894,285 probably null Het
Ptprq A T 10: 107,643,070 probably null Het
Rab18 T A 18: 6,788,629 C199S probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Sacs A G 14: 61,212,802 N4099S probably damaging Het
Sh3yl1 T A 12: 30,942,870 probably null Het
Slco1c1 T A 6: 141,546,689 I217N probably damaging Het
Syne2 C T 12: 76,096,904 T6241I probably damaging Het
Tas2r119 T C 15: 32,178,151 F288L possibly damaging Het
Tmod2 G T 9: 75,592,649 T107N probably benign Het
Trappc6b T C 12: 59,050,381 T52A probably damaging Het
Tsen54 A G 11: 115,815,406 E122G probably damaging Het
Tspear A G 10: 77,873,269 N443S probably damaging Het
Unc80 A G 1: 66,623,206 probably benign Het
Virma T A 4: 11,518,927 Y725N probably damaging Het
Vwa7 G A 17: 35,019,043 D207N probably benign Het
Other mutations in Plk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Plk1 APN 7 122168925 missense probably damaging 0.96
IGL02895:Plk1 APN 7 122169166 missense possibly damaging 0.91
IGL03143:Plk1 APN 7 122161654 intron probably benign
R0018:Plk1 UTSW 7 122168985 critical splice donor site probably null
R1365:Plk1 UTSW 7 122168629 missense probably damaging 1.00
R1710:Plk1 UTSW 7 122168898 missense probably damaging 1.00
R2016:Plk1 UTSW 7 122162440 missense probably damaging 1.00
R2327:Plk1 UTSW 7 122159895 missense probably benign
R4887:Plk1 UTSW 7 122168605 missense probably damaging 1.00
R6246:Plk1 UTSW 7 122169436 missense probably damaging 1.00
R7698:Plk1 UTSW 7 122169258 missense probably damaging 1.00
Z1176:Plk1 UTSW 7 122167650 missense not run
Z1177:Plk1 UTSW 7 122167650 missense not run
Predicted Primers PCR Primer
(F):5'- GGTAGGTGTCCCAGAATGTG -3'
(R):5'- ATTCCAGAATGAGGGCCTGG -3'

Sequencing Primer
(F):5'- CAGAATGTGGAATGGGCAGG -3'
(R):5'- CCTCGACAGCCAGGACTC -3'
Posted On2014-10-15