Incidental Mutation 'R2248:Tmod2'
ID240957
Institutional Source Beutler Lab
Gene Symbol Tmod2
Ensembl Gene ENSMUSG00000032186
Gene Nametropomodulin 2
SynonymsNTMOD, neural tropomodulin, N-Tmod
MMRRC Submission 040248-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2248 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75565621-75611325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75592649 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 107 (T107N)
Ref Sequence ENSEMBL: ENSMUSP00000150645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064433] [ENSMUST00000098552] [ENSMUST00000164100] [ENSMUST00000213565] [ENSMUST00000215036] [ENSMUST00000215462] [ENSMUST00000215614] [ENSMUST00000217233]
Predicted Effect probably benign
Transcript: ENSMUST00000064433
AA Change: T107N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069956
Gene: ENSMUSG00000032186
AA Change: T107N

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 147 1.7e-68 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098552
AA Change: T107N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096152
Gene: ENSMUSG00000032186
AA Change: T107N

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 147 1.7e-68 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164100
AA Change: T107N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126739
Gene: ENSMUSG00000032186
AA Change: T107N

DomainStartEndE-ValueType
Pfam:Tropomodulin 5 146 6.3e-59 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213565
AA Change: T107N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214581
Predicted Effect probably benign
Transcript: ENSMUST00000215036
AA Change: T107N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215462
AA Change: T107N

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215614
AA Change: T107N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000217233
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal-specific member of the tropomodulin family of actin-regulatory proteins. The encoded protein caps the pointed end of actin filaments preventing both elongation and depolymerization. The capping activity of this protein is dependent on its association with tropomyosin. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in enhanced LTP, hyperactivity, impaired startle response, and impaired learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,114 T482A probably benign Het
Abca2 A G 2: 25,433,464 probably benign Het
Afp A G 5: 90,501,570 D332G probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aldh1a2 A T 9: 71,215,862 I6F possibly damaging Het
Alg6 C T 4: 99,738,207 A84V probably damaging Het
Ank T A 15: 27,562,711 probably null Het
Ano5 A T 7: 51,593,789 M837L probably benign Het
Arl8b A G 6: 108,783,343 Y30C probably benign Het
Bfsp1 A T 2: 143,827,652 probably null Het
Cdhr1 C G 14: 37,081,377 V581L probably benign Het
Chst8 G T 7: 34,748,172 T7K probably damaging Het
Clca3b T C 3: 144,825,219 K790R probably benign Het
Clta A G 4: 44,012,852 N21D probably damaging Het
Col6a4 T G 9: 106,079,959 E222A probably benign Het
Dcc G T 18: 71,826,168 Q178K probably benign Het
Dpysl3 T C 18: 43,358,293 D140G possibly damaging Het
Dthd1 A T 5: 62,849,900 D648V probably damaging Het
Eva1c A G 16: 90,831,325 N18S probably benign Het
Flnc A G 6: 29,451,401 H1538R probably damaging Het
Foxn3 T C 12: 99,196,556 E362G probably benign Het
Frk C A 10: 34,608,531 T500K probably benign Het
Glipr1l1 A G 10: 112,062,287 E99G probably benign Het
Gm6169 C A 13: 97,098,898 V114F possibly damaging Het
Gphn T C 12: 78,454,821 L120P probably damaging Het
Gpr152 T C 19: 4,143,806 S449P probably benign Het
Greb1 T A 12: 16,680,378 I1655F possibly damaging Het
Hectd1 G T 12: 51,806,471 T89N probably damaging Het
Helz2 A C 2: 181,233,433 I1756S probably benign Het
Hydin G T 8: 110,578,203 R3825L probably benign Het
Ifi207 G A 1: 173,736,470 probably benign Het
Itpr3 A T 17: 27,115,059 E2035V probably damaging Het
Khnyn T A 14: 55,886,738 S150T probably benign Het
Kif21b T C 1: 136,172,966 I1595T probably damaging Het
Lgsn A T 1: 31,203,526 T230S possibly damaging Het
Limch1 G T 5: 67,044,399 G838V probably damaging Het
Lrp2 T A 2: 69,511,010 D942V probably damaging Het
Lrrc31 T A 3: 30,689,901 T153S possibly damaging Het
Mal2 T A 15: 54,588,336 I51N probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mycbp2 T A 14: 103,169,859 Q385L possibly damaging Het
Nav3 T A 10: 109,696,227 D2117V probably damaging Het
Ntn1 T C 11: 68,277,572 N353S possibly damaging Het
Oas1c T C 5: 120,802,861 E289G possibly damaging Het
Olfr1141 T C 2: 87,753,943 I17V probably null Het
Olfr1254 C A 2: 89,789,180 M57I possibly damaging Het
Olfr165 A G 16: 19,407,194 V274A probably damaging Het
Plk1 A G 7: 122,168,821 probably benign Het
Pms2 G A 5: 143,916,506 V230M probably damaging Het
Pole3 C A 4: 62,525,013 probably benign Het
Ppp2r5c T C 12: 110,485,923 F22S probably benign Het
Ptcd3 A T 6: 71,894,285 probably null Het
Ptprq A T 10: 107,643,070 probably null Het
Rab18 T A 18: 6,788,629 C199S probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Sacs A G 14: 61,212,802 N4099S probably damaging Het
Sh3yl1 T A 12: 30,942,870 probably null Het
Slco1c1 T A 6: 141,546,689 I217N probably damaging Het
Syne2 C T 12: 76,096,904 T6241I probably damaging Het
Tas2r119 T C 15: 32,178,151 F288L possibly damaging Het
Trappc6b T C 12: 59,050,381 T52A probably damaging Het
Tsen54 A G 11: 115,815,406 E122G probably damaging Het
Tspear A G 10: 77,873,269 N443S probably damaging Het
Unc80 A G 1: 66,623,206 probably benign Het
Virma T A 4: 11,518,927 Y725N probably damaging Het
Vwa7 G A 17: 35,019,043 D207N probably benign Het
Other mutations in Tmod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Tmod2 APN 9 75595001 missense probably benign 0.00
IGL02732:Tmod2 APN 9 75586172 missense possibly damaging 0.94
IGL03255:Tmod2 APN 9 75577258 splice site probably benign
PIT4581001:Tmod2 UTSW 9 75597301 missense probably damaging 1.00
R0589:Tmod2 UTSW 9 75576759 missense probably damaging 1.00
R0723:Tmod2 UTSW 9 75595055 missense possibly damaging 0.93
R1721:Tmod2 UTSW 9 75586042 splice site probably benign
R2056:Tmod2 UTSW 9 75577242 missense probably benign 0.00
R2119:Tmod2 UTSW 9 75586095 missense possibly damaging 0.46
R4522:Tmod2 UTSW 9 75592584 missense probably benign 0.10
R4755:Tmod2 UTSW 9 75597212 nonsense probably null
R7149:Tmod2 UTSW 9 75581885 missense possibly damaging 0.52
R7363:Tmod2 UTSW 9 75576741 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTCCAGTCTGATAGGTAGATAG -3'
(R):5'- TAGCCCCATCAGATGACAGG -3'

Sequencing Primer
(F):5'- TGGGCACACAGTATTCAATAGC -3'
(R):5'- GAAACAGCTCAATGGCGTGTGTC -3'
Posted On2014-10-15