Incidental Mutation 'R2214:Ubap2'
ID241004
Institutional Source Beutler Lab
Gene Symbol Ubap2
Ensembl Gene ENSMUSG00000028433
Gene Nameubiquitin-associated protein 2
Synonyms1190005K07Rik
MMRRC Submission 040216-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R2214 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41194313-41275144 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 41199714 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000030143] [ENSMUST00000108068] [ENSMUST00000108068]
Predicted Effect probably null
Transcript: ENSMUST00000030143
SMART Domains Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433

DomainStartEndE-ValueType
UBA 53 91 9.62e-8 SMART
low complexity region 115 127 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 256 266 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Pfam:DUF3697 512 544 1.5e-18 PFAM
low complexity region 583 618 N/A INTRINSIC
low complexity region 631 644 N/A INTRINSIC
low complexity region 696 722 N/A INTRINSIC
low complexity region 744 768 N/A INTRINSIC
low complexity region 787 800 N/A INTRINSIC
low complexity region 888 914 N/A INTRINSIC
low complexity region 1007 1024 N/A INTRINSIC
low complexity region 1057 1078 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
low complexity region 1101 1115 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000030143
SMART Domains Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433

DomainStartEndE-ValueType
UBA 53 91 9.62e-8 SMART
low complexity region 115 127 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 256 266 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Pfam:DUF3697 512 544 1.5e-18 PFAM
low complexity region 583 618 N/A INTRINSIC
low complexity region 631 644 N/A INTRINSIC
low complexity region 696 722 N/A INTRINSIC
low complexity region 744 768 N/A INTRINSIC
low complexity region 787 800 N/A INTRINSIC
low complexity region 888 914 N/A INTRINSIC
low complexity region 1007 1024 N/A INTRINSIC
low complexity region 1057 1078 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
low complexity region 1101 1115 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108068
SMART Domains Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433

DomainStartEndE-ValueType
UBA 52 90 9.62e-8 SMART
low complexity region 114 126 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
Pfam:DUF3697 511 543 1.2e-20 PFAM
low complexity region 582 617 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 695 721 N/A INTRINSIC
low complexity region 743 767 N/A INTRINSIC
low complexity region 786 799 N/A INTRINSIC
low complexity region 887 913 N/A INTRINSIC
low complexity region 1006 1023 N/A INTRINSIC
low complexity region 1056 1077 N/A INTRINSIC
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108068
SMART Domains Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433

DomainStartEndE-ValueType
UBA 52 90 9.62e-8 SMART
low complexity region 114 126 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
Pfam:DUF3697 511 543 1.2e-20 PFAM
low complexity region 582 617 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 695 721 N/A INTRINSIC
low complexity region 743 767 N/A INTRINSIC
low complexity region 786 799 N/A INTRINSIC
low complexity region 887 913 N/A INTRINSIC
low complexity region 1006 1023 N/A INTRINSIC
low complexity region 1056 1077 N/A INTRINSIC
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136057
SMART Domains Protein: ENSMUSP00000120205
Gene: ENSMUSG00000028433

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 49 70 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158640
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,108,128 Y516C probably benign Het
Adam22 C T 5: 8,136,805 probably null Het
Akap8l T C 17: 32,338,825 probably null Het
BC003965 T C 17: 25,184,725 V13A probably benign Het
Casr T C 16: 36,515,758 Y63C probably damaging Het
Ccdc178 T C 18: 21,914,990 D781G possibly damaging Het
Col9a1 C A 1: 24,208,202 P168Q probably damaging Het
Dnm2 T C 9: 21,485,723 probably null Het
Dst C T 1: 34,271,401 T6325M probably damaging Het
Ercc4 C A 16: 13,110,024 D19E probably damaging Het
Gm1110 C A 9: 26,902,490 V198L probably benign Het
Gm8674 T A 13: 49,901,360 noncoding transcript Het
Grm7 A T 6: 111,358,997 I790F probably damaging Het
Habp2 A G 19: 56,317,817 D445G possibly damaging Het
Kat7 G A 11: 95,275,805 T517I probably damaging Het
Kbtbd11 T A 8: 15,029,178 D592E possibly damaging Het
Lgals8 T A 13: 12,454,832 Q82L probably benign Het
Lmtk3 A G 7: 45,794,853 probably benign Het
Map2 A T 1: 66,420,186 D1530V probably damaging Het
Map2k6 G A 11: 110,496,341 V180I probably damaging Het
Map3k5 T A 10: 20,026,289 probably null Het
Mtor A G 4: 148,538,870 E2059G probably benign Het
Myh10 A G 11: 68,783,127 D660G probably damaging Het
Myo16 T A 8: 10,438,803 V658E probably damaging Het
Nckap5 A T 1: 126,025,750 S1090T possibly damaging Het
Nhlrc3 T C 3: 53,456,454 H217R probably damaging Het
Ntrk3 T A 7: 78,516,772 I118F probably damaging Het
Olfr1181 C T 2: 88,423,117 V303M probably benign Het
Olfr305 T A 7: 86,364,206 I44F probably benign Het
Olfr389 A T 11: 73,776,829 L166* probably null Het
Paxip1 T C 5: 27,742,501 Y1053C probably damaging Het
Pfkfb4 T A 9: 109,005,609 F117I probably benign Het
Pp2d1 T C 17: 53,515,396 Y214C probably benign Het
Prr7 C A 13: 55,472,800 S207* probably null Het
Ptprh T A 7: 4,552,922 Q715L possibly damaging Het
Rasgrp1 A T 2: 117,285,165 D647E probably damaging Het
Rnf20 T A 4: 49,648,344 M384K possibly damaging Het
Rps6kb1 A T 11: 86,534,070 C37S possibly damaging Het
Serpinb9f C A 13: 33,334,609 T364K probably benign Het
Sorbs1 C T 19: 40,296,631 A641T probably damaging Het
Srrm2 T C 17: 23,816,745 probably benign Het
Stag3 C T 5: 138,301,266 S849L possibly damaging Het
Syt15 A T 14: 34,223,032 S179C probably damaging Het
Tapbp T C 17: 33,920,326 F90L possibly damaging Het
Timm23 A T 14: 32,198,987 D49E probably damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem174 A C 13: 98,637,249 S24R possibly damaging Het
Tmem63a A G 1: 180,961,114 S339G probably benign Het
Tsc22d2 A G 3: 58,416,206 Y173C probably damaging Het
Upp1 T A 11: 9,136,033 V290E probably benign Het
Usp17lb A T 7: 104,841,432 M96K probably benign Het
Wdr20rt A G 12: 65,227,413 E449G probably damaging Het
Zkscan8 A T 13: 21,520,912 S286T probably benign Het
Other mutations in Ubap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2 APN 4 41195328 splice site probably benign
IGL01109:Ubap2 APN 4 41195155 missense probably damaging 1.00
IGL01354:Ubap2 APN 4 41207005 missense probably damaging 1.00
IGL01563:Ubap2 APN 4 41195998 missense probably damaging 0.96
IGL01602:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01605:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01688:Ubap2 APN 4 41226308 missense probably benign
IGL01733:Ubap2 APN 4 41195862 unclassified probably benign
IGL01896:Ubap2 APN 4 41202362 missense possibly damaging 0.85
IGL01942:Ubap2 APN 4 41251608 missense probably benign 0.00
IGL02095:Ubap2 APN 4 41229709 missense probably benign
R0608:Ubap2 UTSW 4 41218319 missense probably benign 0.10
R0938:Ubap2 UTSW 4 41202304 missense probably damaging 1.00
R1449:Ubap2 UTSW 4 41209351 critical splice donor site probably null
R1484:Ubap2 UTSW 4 41235593 missense probably damaging 1.00
R1548:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1549:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1604:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1607:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1739:Ubap2 UTSW 4 41206849 missense probably benign 0.00
R1772:Ubap2 UTSW 4 41202380 missense probably benign 0.02
R1862:Ubap2 UTSW 4 41221607 missense probably benign
R1869:Ubap2 UTSW 4 41233617 missense probably damaging 1.00
R1886:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1887:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2063:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2064:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2065:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2066:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2095:Ubap2 UTSW 4 41206901 missense possibly damaging 0.68
R2215:Ubap2 UTSW 4 41196483 unclassified probably null
R2318:Ubap2 UTSW 4 41251542 missense probably damaging 0.99
R3755:Ubap2 UTSW 4 41195482 missense probably damaging 1.00
R4620:Ubap2 UTSW 4 41233698 missense probably damaging 1.00
R4717:Ubap2 UTSW 4 41218333 missense possibly damaging 0.93
R4756:Ubap2 UTSW 4 41211771 missense probably damaging 1.00
R4942:Ubap2 UTSW 4 41245461 intron probably benign
R5344:Ubap2 UTSW 4 41251578 missense possibly damaging 0.46
R5763:Ubap2 UTSW 4 41195809 missense probably damaging 1.00
R5851:Ubap2 UTSW 4 41206268 nonsense probably null
R5951:Ubap2 UTSW 4 41205753 unclassified probably null
R6178:Ubap2 UTSW 4 41206981 missense probably benign
R6489:Ubap2 UTSW 4 41203574 critical splice acceptor site probably null
R6520:Ubap2 UTSW 4 41195155 missense probably damaging 1.00
R6652:Ubap2 UTSW 4 41196743 missense possibly damaging 0.68
R6702:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227224 small insertion probably benign
R6860:Ubap2 UTSW 4 41233631 missense probably damaging 1.00
R7007:Ubap2 UTSW 4 41206221 missense probably damaging 0.97
R7048:Ubap2 UTSW 4 41196033 missense possibly damaging 0.49
R7121:Ubap2 UTSW 4 41205550 missense probably benign 0.00
R7371:Ubap2 UTSW 4 41195779 missense probably benign 0.16
R7378:Ubap2 UTSW 4 41235515 critical splice donor site probably null
R7695:Ubap2 UTSW 4 41211740 missense probably damaging 0.98
R7811:Ubap2 UTSW 4 41211710 missense probably benign 0.22
R7828:Ubap2 UTSW 4 41221615 missense probably benign 0.00
R7838:Ubap2 UTSW 4 41233655 missense probably damaging 1.00
R8016:Ubap2 UTSW 4 41195201 missense possibly damaging 0.91
X0061:Ubap2 UTSW 4 41196507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAGGTACTGATTGTGTAGCAG -3'
(R):5'- TAGGCCCTTCGTTCTGACTG -3'

Sequencing Primer
(F):5'- TTGTGTAGCAGGGGAGGCAC -3'
(R):5'- GTTTTGCCAGCATGCCAG -3'
Posted On2014-10-15