Incidental Mutation 'R2214:Ptprh'
ID241014
Institutional Source Beutler Lab
Gene Symbol Ptprh
Ensembl Gene ENSMUSG00000035429
Gene Nameprotein tyrosine phosphatase, receptor type, H
SynonymsSAP-1
MMRRC Submission 040216-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2214 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4548612-4604041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4552922 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 715 (Q715L)
Ref Sequence ENSEMBL: ENSMUSP00000145543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049113
AA Change: Q715L

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: Q715L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166650
AA Change: Q715L

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: Q715L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205417
Predicted Effect possibly damaging
Transcript: ENSMUST00000206999
AA Change: Q715L

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,108,128 Y516C probably benign Het
Adam22 C T 5: 8,136,805 probably null Het
Akap8l T C 17: 32,338,825 probably null Het
BC003965 T C 17: 25,184,725 V13A probably benign Het
Casr T C 16: 36,515,758 Y63C probably damaging Het
Ccdc178 T C 18: 21,914,990 D781G possibly damaging Het
Col9a1 C A 1: 24,208,202 P168Q probably damaging Het
Dnm2 T C 9: 21,485,723 probably null Het
Dst C T 1: 34,271,401 T6325M probably damaging Het
Ercc4 C A 16: 13,110,024 D19E probably damaging Het
Gm1110 C A 9: 26,902,490 V198L probably benign Het
Gm8674 T A 13: 49,901,360 noncoding transcript Het
Grm7 A T 6: 111,358,997 I790F probably damaging Het
Habp2 A G 19: 56,317,817 D445G possibly damaging Het
Kat7 G A 11: 95,275,805 T517I probably damaging Het
Kbtbd11 T A 8: 15,029,178 D592E possibly damaging Het
Lgals8 T A 13: 12,454,832 Q82L probably benign Het
Lmtk3 A G 7: 45,794,853 probably benign Het
Map2 A T 1: 66,420,186 D1530V probably damaging Het
Map2k6 G A 11: 110,496,341 V180I probably damaging Het
Map3k5 T A 10: 20,026,289 probably null Het
Mtor A G 4: 148,538,870 E2059G probably benign Het
Myh10 A G 11: 68,783,127 D660G probably damaging Het
Myo16 T A 8: 10,438,803 V658E probably damaging Het
Nckap5 A T 1: 126,025,750 S1090T possibly damaging Het
Nhlrc3 T C 3: 53,456,454 H217R probably damaging Het
Ntrk3 T A 7: 78,516,772 I118F probably damaging Het
Olfr1181 C T 2: 88,423,117 V303M probably benign Het
Olfr305 T A 7: 86,364,206 I44F probably benign Het
Olfr389 A T 11: 73,776,829 L166* probably null Het
Paxip1 T C 5: 27,742,501 Y1053C probably damaging Het
Pfkfb4 T A 9: 109,005,609 F117I probably benign Het
Pp2d1 T C 17: 53,515,396 Y214C probably benign Het
Prr7 C A 13: 55,472,800 S207* probably null Het
Rasgrp1 A T 2: 117,285,165 D647E probably damaging Het
Rnf20 T A 4: 49,648,344 M384K possibly damaging Het
Rps6kb1 A T 11: 86,534,070 C37S possibly damaging Het
Serpinb9f C A 13: 33,334,609 T364K probably benign Het
Sorbs1 C T 19: 40,296,631 A641T probably damaging Het
Srrm2 T C 17: 23,816,745 probably benign Het
Stag3 C T 5: 138,301,266 S849L possibly damaging Het
Syt15 A T 14: 34,223,032 S179C probably damaging Het
Tapbp T C 17: 33,920,326 F90L possibly damaging Het
Timm23 A T 14: 32,198,987 D49E probably damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem174 A C 13: 98,637,249 S24R possibly damaging Het
Tmem63a A G 1: 180,961,114 S339G probably benign Het
Tsc22d2 A G 3: 58,416,206 Y173C probably damaging Het
Ubap2 A G 4: 41,199,714 probably null Het
Upp1 T A 11: 9,136,033 V290E probably benign Het
Usp17lb A T 7: 104,841,432 M96K probably benign Het
Wdr20rt A G 12: 65,227,413 E449G probably damaging Het
Zkscan8 A T 13: 21,520,912 S286T probably benign Het
Other mutations in Ptprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Ptprh APN 7 4580916 missense probably benign 0.23
IGL02420:Ptprh APN 7 4580930 missense probably damaging 1.00
IGL02619:Ptprh APN 7 4549499 missense probably damaging 1.00
IGL02729:Ptprh APN 7 4580874 missense probably damaging 0.99
R0018:Ptprh UTSW 7 4601846 critical splice donor site probably null
R0049:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R0449:Ptprh UTSW 7 4598006 missense probably damaging 1.00
R0477:Ptprh UTSW 7 4597998 missense possibly damaging 0.87
R0626:Ptprh UTSW 7 4564272 missense probably benign 0.00
R0741:Ptprh UTSW 7 4554173 critical splice donor site probably null
R1068:Ptprh UTSW 7 4549463 missense possibly damaging 0.89
R1226:Ptprh UTSW 7 4603092 nonsense probably null
R1487:Ptprh UTSW 7 4552738 missense probably damaging 1.00
R1495:Ptprh UTSW 7 4580889 missense probably benign 0.02
R1537:Ptprh UTSW 7 4549699 missense probably damaging 1.00
R1601:Ptprh UTSW 7 4552638 missense probably damaging 1.00
R1731:Ptprh UTSW 7 4601913 missense probably benign 0.00
R1920:Ptprh UTSW 7 4549395 missense probably benign 0.25
R2082:Ptprh UTSW 7 4550775 missense probably damaging 1.00
R2180:Ptprh UTSW 7 4601868 missense probably benign 0.26
R2245:Ptprh UTSW 7 4573346 missense probably benign 0.09
R2271:Ptprh UTSW 7 4603133 start gained probably benign
R3693:Ptprh UTSW 7 4554235 missense probably damaging 0.99
R3713:Ptprh UTSW 7 4571970 missense probably damaging 1.00
R4081:Ptprh UTSW 7 4580988 missense probably damaging 0.99
R4205:Ptprh UTSW 7 4597992 missense probably damaging 1.00
R4689:Ptprh UTSW 7 4597997 missense possibly damaging 0.74
R4782:Ptprh UTSW 7 4569577 missense probably benign 0.08
R4838:Ptprh UTSW 7 4573430 missense possibly damaging 0.78
R4974:Ptprh UTSW 7 4551007 splice site probably null
R5218:Ptprh UTSW 7 4597920 missense probably benign 0.05
R5430:Ptprh UTSW 7 4551047 missense probably damaging 1.00
R5533:Ptprh UTSW 7 4549505 missense probably damaging 1.00
R5544:Ptprh UTSW 7 4580910 nonsense probably null
R5547:Ptprh UTSW 7 4554222 nonsense probably null
R5869:Ptprh UTSW 7 4601940 missense probably benign 0.00
R5928:Ptprh UTSW 7 4573508 missense probably damaging 1.00
R6063:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R6112:Ptprh UTSW 7 4597923 missense probably benign 0.01
R6493:Ptprh UTSW 7 4580990 missense possibly damaging 0.65
R6733:Ptprh UTSW 7 4603044 splice site probably null
R6836:Ptprh UTSW 7 4551135 missense probably damaging 1.00
R6859:Ptprh UTSW 7 4549371 nonsense probably null
R6868:Ptprh UTSW 7 4601865 missense probably benign
R7015:Ptprh UTSW 7 4552627 critical splice donor site probably null
R7092:Ptprh UTSW 7 4580861 critical splice donor site probably null
R7147:Ptprh UTSW 7 4550782 missense probably damaging 1.00
R7177:Ptprh UTSW 7 4569481 missense possibly damaging 0.77
R7358:Ptprh UTSW 7 4551007 splice site probably null
R7436:Ptprh UTSW 7 4552743 missense probably damaging 1.00
R7512:Ptprh UTSW 7 4571781 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GGGTTGCAATGAACTCCTTGGG -3'
(R):5'- TCACAGCCTGCTTGTCATTG -3'

Sequencing Primer
(F):5'- AATGAACTCCTTGGGGCTCCAG -3'
(R):5'- CAGACCCTCTCACAGCCTG -3'
Posted On2014-10-15