Incidental Mutation 'R2214:Myo16'
ID241021
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Namemyosin XVI
SynonymsBM140241, C230040D10Rik, Nyap3
MMRRC Submission 040216-MU
Accession Numbers

Genbank: NM_001081397; MGI: 2685951

Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R2214 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location10153911-10634742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10438803 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 658 (V658E)
Ref Sequence ENSEMBL: ENSMUSP00000049345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207477]
Predicted Effect probably damaging
Transcript: ENSMUST00000042103
AA Change: V658E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057
AA Change: V658E

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207204
Predicted Effect unknown
Transcript: ENSMUST00000207477
AA Change: V658E
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,108,128 Y516C probably benign Het
Adam22 C T 5: 8,136,805 probably null Het
Akap8l T C 17: 32,338,825 probably null Het
BC003965 T C 17: 25,184,725 V13A probably benign Het
Casr T C 16: 36,515,758 Y63C probably damaging Het
Ccdc178 T C 18: 21,914,990 D781G possibly damaging Het
Col9a1 C A 1: 24,208,202 P168Q probably damaging Het
Dnm2 T C 9: 21,485,723 probably null Het
Dst C T 1: 34,271,401 T6325M probably damaging Het
Ercc4 C A 16: 13,110,024 D19E probably damaging Het
Gm1110 C A 9: 26,902,490 V198L probably benign Het
Gm8674 T A 13: 49,901,360 noncoding transcript Het
Grm7 A T 6: 111,358,997 I790F probably damaging Het
Habp2 A G 19: 56,317,817 D445G possibly damaging Het
Kat7 G A 11: 95,275,805 T517I probably damaging Het
Kbtbd11 T A 8: 15,029,178 D592E possibly damaging Het
Lgals8 T A 13: 12,454,832 Q82L probably benign Het
Lmtk3 A G 7: 45,794,853 probably benign Het
Map2 A T 1: 66,420,186 D1530V probably damaging Het
Map2k6 G A 11: 110,496,341 V180I probably damaging Het
Map3k5 T A 10: 20,026,289 probably null Het
Mtor A G 4: 148,538,870 E2059G probably benign Het
Myh10 A G 11: 68,783,127 D660G probably damaging Het
Nckap5 A T 1: 126,025,750 S1090T possibly damaging Het
Nhlrc3 T C 3: 53,456,454 H217R probably damaging Het
Ntrk3 T A 7: 78,516,772 I118F probably damaging Het
Olfr1181 C T 2: 88,423,117 V303M probably benign Het
Olfr305 T A 7: 86,364,206 I44F probably benign Het
Olfr389 A T 11: 73,776,829 L166* probably null Het
Paxip1 T C 5: 27,742,501 Y1053C probably damaging Het
Pfkfb4 T A 9: 109,005,609 F117I probably benign Het
Pp2d1 T C 17: 53,515,396 Y214C probably benign Het
Prr7 C A 13: 55,472,800 S207* probably null Het
Ptprh T A 7: 4,552,922 Q715L possibly damaging Het
Rasgrp1 A T 2: 117,285,165 D647E probably damaging Het
Rnf20 T A 4: 49,648,344 M384K possibly damaging Het
Rps6kb1 A T 11: 86,534,070 C37S possibly damaging Het
Serpinb9f C A 13: 33,334,609 T364K probably benign Het
Sorbs1 C T 19: 40,296,631 A641T probably damaging Het
Srrm2 T C 17: 23,816,745 probably benign Het
Stag3 C T 5: 138,301,266 S849L possibly damaging Het
Syt15 A T 14: 34,223,032 S179C probably damaging Het
Tapbp T C 17: 33,920,326 F90L possibly damaging Het
Timm23 A T 14: 32,198,987 D49E probably damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem174 A C 13: 98,637,249 S24R possibly damaging Het
Tmem63a A G 1: 180,961,114 S339G probably benign Het
Tsc22d2 A G 3: 58,416,206 Y173C probably damaging Het
Ubap2 A G 4: 41,199,714 probably null Het
Upp1 T A 11: 9,136,033 V290E probably benign Het
Usp17lb A T 7: 104,841,432 M96K probably benign Het
Wdr20rt A G 12: 65,227,413 E449G probably damaging Het
Zkscan8 A T 13: 21,520,912 S286T probably benign Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10438889 missense probably damaging 1.00
IGL00567:Myo16 APN 8 10462154 missense probably damaging 1.00
IGL00671:Myo16 APN 8 10361067 missense probably damaging 1.00
IGL00897:Myo16 APN 8 10315518 missense probably damaging 1.00
IGL01458:Myo16 APN 8 10435853 missense probably damaging 1.00
IGL01523:Myo16 APN 8 10370908 missense probably damaging 1.00
IGL01532:Myo16 APN 8 10400551 missense probably benign 0.00
IGL01680:Myo16 APN 8 10272630 missense probably damaging 1.00
IGL01747:Myo16 APN 8 10604877 missense probably damaging 1.00
IGL02084:Myo16 APN 8 10361088 missense probably damaging 0.99
IGL02203:Myo16 APN 8 10570132 missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10390217 missense probably damaging 1.00
IGL02819:Myo16 APN 8 10322600 missense probably damaging 1.00
IGL02935:Myo16 APN 8 10532990 missense probably benign 0.41
IGL02943:Myo16 APN 8 10400595 splice site probably benign
IGL03347:Myo16 APN 8 10376120 critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10438869 missense probably damaging 0.99
P0016:Myo16 UTSW 8 10400596 splice site probably benign
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0142:Myo16 UTSW 8 10569790 missense probably benign 0.01
R0195:Myo16 UTSW 8 10315538 splice site probably benign
R0418:Myo16 UTSW 8 10569918 missense probably benign 0.01
R0576:Myo16 UTSW 8 10562318 critical splice donor site probably null
R0627:Myo16 UTSW 8 10439689 missense probably benign 0.15
R0826:Myo16 UTSW 8 10376285 splice site probably benign
R0835:Myo16 UTSW 8 10272766 missense probably damaging 1.00
R1015:Myo16 UTSW 8 10390183 missense probably benign 0.17
R1052:Myo16 UTSW 8 10570181 missense possibly damaging 0.92
R1180:Myo16 UTSW 8 10396908 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1474:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R1484:Myo16 UTSW 8 10560145 missense probably damaging 1.00
R1503:Myo16 UTSW 8 10502817 missense probably benign 0.44
R1733:Myo16 UTSW 8 10442283 missense probably damaging 0.98
R1873:Myo16 UTSW 8 10272789 missense probably damaging 1.00
R1885:Myo16 UTSW 8 10322656 missense probably damaging 1.00
R1943:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2013:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R2019:Myo16 UTSW 8 10376260 missense probably benign 0.05
R2022:Myo16 UTSW 8 10272633 missense probably benign 0.08
R2228:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10594820 missense probably benign 0.43
R3402:Myo16 UTSW 8 10384719 missense probably benign
R3870:Myo16 UTSW 8 10442239 missense probably benign 0.25
R4080:Myo16 UTSW 8 10562240 missense probably damaging 1.00
R4498:Myo16 UTSW 8 10435869 missense probably benign 0.01
R4631:Myo16 UTSW 8 10506984 missense probably damaging 1.00
R4689:Myo16 UTSW 8 10438890 missense probably damaging 1.00
R4736:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4738:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4739:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4764:Myo16 UTSW 8 10435880 missense probably damaging 1.00
R4778:Myo16 UTSW 8 10569694 missense probably damaging 0.97
R4852:Myo16 UTSW 8 10373474 missense probably damaging 1.00
R4885:Myo16 UTSW 8 10438892 missense probably damaging 0.98
R4993:Myo16 UTSW 8 10476094 missense probably damaging 0.99
R5077:Myo16 UTSW 8 10322658 missense probably damaging 1.00
R5135:Myo16 UTSW 8 10476114 missense probably benign
R5170:Myo16 UTSW 8 10569745 missense probably benign 0.30
R5203:Myo16 UTSW 8 10360995 missense probably damaging 1.00
R5246:Myo16 UTSW 8 10562212 nonsense probably null
R5517:Myo16 UTSW 8 10560226 missense probably benign 0.22
R5567:Myo16 UTSW 8 10322676 missense probably damaging 1.00
R5694:Myo16 UTSW 8 10569606 missense probably benign 0.01
R5749:Myo16 UTSW 8 10413245 missense probably benign 0.01
R6131:Myo16 UTSW 8 10569877 missense probably benign
R6213:Myo16 UTSW 8 10370963 critical splice donor site probably null
R6216:Myo16 UTSW 8 10315494 missense probably benign 0.01
R6240:Myo16 UTSW 8 10370930 missense probably damaging 1.00
R6628:Myo16 UTSW 8 10570638 missense probably damaging 0.99
R6935:Myo16 UTSW 8 10569820 missense probably benign 0.37
R6996:Myo16 UTSW 8 10569496 missense probably damaging 1.00
R7103:Myo16 UTSW 8 10569673 missense unknown
R7164:Myo16 UTSW 8 10569585 missense unknown
R7255:Myo16 UTSW 8 10499169 missense unknown
R7266:Myo16 UTSW 8 10272687 missense unknown
R7319:Myo16 UTSW 8 10476185 splice site probably null
R7398:Myo16 UTSW 8 10562183 missense unknown
R7442:Myo16 UTSW 8 10272537 missense probably damaging 1.00
R7498:Myo16 UTSW 8 10400589 missense unknown
R7539:Myo16 UTSW 8 10361095 critical splice donor site probably null
R7622:Myo16 UTSW 8 10376238 missense unknown
R7794:Myo16 UTSW 8 10569913 missense unknown
R7903:Myo16 UTSW 8 10376265 missense probably null
R8055:Myo16 UTSW 8 10562186 missense unknown
R8078:Myo16 UTSW 8 10562078 missense unknown
R8081:Myo16 UTSW 8 10322743 missense unknown
X0066:Myo16 UTSW 8 10376185 missense probably damaging 1.00
Z1177:Myo16 UTSW 8 10474691 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAGAACAGCAATTTAGGGC -3'
(R):5'- CTAGTGATTGTTGCAGCCAGC -3'

Sequencing Primer
(F):5'- CAATTTAGGGCAACGCACATG -3'
(R):5'- CATCTGCTGGCAAAACTGTG -3'
Posted On2014-10-15