Incidental Mutation 'R2214:Pfkfb4'
ID241027
Institutional Source Beutler Lab
Gene Symbol Pfkfb4
Ensembl Gene ENSMUSG00000025648
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Synonyms
MMRRC Submission 040216-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2214 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108991778-109032228 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109005609 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 117 (F117I)
Ref Sequence ENSEMBL: ENSMUSP00000142992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]
Predicted Effect probably benign
Transcript: ENSMUST00000051873
AA Change: F101I

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648
AA Change: F101I

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 3.2e-105 PFAM
Pfam:AAA_33 41 199 2.3e-8 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196249
Predicted Effect probably benign
Transcript: ENSMUST00000198140
AA Change: F117I

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648
AA Change: F117I

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.9e-105 PFAM
Pfam:AAA_33 41 198 8.5e-10 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199184
Predicted Effect probably benign
Transcript: ENSMUST00000199591
AA Change: F117I

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648
AA Change: F117I

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.4e-105 PFAM
Pfam:AAA_33 41 198 6.6e-10 PFAM
PGAM 251 396 4.98e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200229
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,108,128 Y516C probably benign Het
Adam22 C T 5: 8,136,805 probably null Het
Akap8l T C 17: 32,338,825 probably null Het
BC003965 T C 17: 25,184,725 V13A probably benign Het
Casr T C 16: 36,515,758 Y63C probably damaging Het
Ccdc178 T C 18: 21,914,990 D781G possibly damaging Het
Col9a1 C A 1: 24,208,202 P168Q probably damaging Het
Dnm2 T C 9: 21,485,723 probably null Het
Dst C T 1: 34,271,401 T6325M probably damaging Het
Ercc4 C A 16: 13,110,024 D19E probably damaging Het
Gm1110 C A 9: 26,902,490 V198L probably benign Het
Gm8674 T A 13: 49,901,360 noncoding transcript Het
Grm7 A T 6: 111,358,997 I790F probably damaging Het
Habp2 A G 19: 56,317,817 D445G possibly damaging Het
Kat7 G A 11: 95,275,805 T517I probably damaging Het
Kbtbd11 T A 8: 15,029,178 D592E possibly damaging Het
Lgals8 T A 13: 12,454,832 Q82L probably benign Het
Lmtk3 A G 7: 45,794,853 probably benign Het
Map2 A T 1: 66,420,186 D1530V probably damaging Het
Map2k6 G A 11: 110,496,341 V180I probably damaging Het
Map3k5 T A 10: 20,026,289 probably null Het
Mtor A G 4: 148,538,870 E2059G probably benign Het
Myh10 A G 11: 68,783,127 D660G probably damaging Het
Myo16 T A 8: 10,438,803 V658E probably damaging Het
Nckap5 A T 1: 126,025,750 S1090T possibly damaging Het
Nhlrc3 T C 3: 53,456,454 H217R probably damaging Het
Ntrk3 T A 7: 78,516,772 I118F probably damaging Het
Olfr1181 C T 2: 88,423,117 V303M probably benign Het
Olfr305 T A 7: 86,364,206 I44F probably benign Het
Olfr389 A T 11: 73,776,829 L166* probably null Het
Paxip1 T C 5: 27,742,501 Y1053C probably damaging Het
Pp2d1 T C 17: 53,515,396 Y214C probably benign Het
Prr7 C A 13: 55,472,800 S207* probably null Het
Ptprh T A 7: 4,552,922 Q715L possibly damaging Het
Rasgrp1 A T 2: 117,285,165 D647E probably damaging Het
Rnf20 T A 4: 49,648,344 M384K possibly damaging Het
Rps6kb1 A T 11: 86,534,070 C37S possibly damaging Het
Serpinb9f C A 13: 33,334,609 T364K probably benign Het
Sorbs1 C T 19: 40,296,631 A641T probably damaging Het
Srrm2 T C 17: 23,816,745 probably benign Het
Stag3 C T 5: 138,301,266 S849L possibly damaging Het
Syt15 A T 14: 34,223,032 S179C probably damaging Het
Tapbp T C 17: 33,920,326 F90L possibly damaging Het
Timm23 A T 14: 32,198,987 D49E probably damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem174 A C 13: 98,637,249 S24R possibly damaging Het
Tmem63a A G 1: 180,961,114 S339G probably benign Het
Tsc22d2 A G 3: 58,416,206 Y173C probably damaging Het
Ubap2 A G 4: 41,199,714 probably null Het
Upp1 T A 11: 9,136,033 V290E probably benign Het
Usp17lb A T 7: 104,841,432 M96K probably benign Het
Wdr20rt A G 12: 65,227,413 E449G probably damaging Het
Zkscan8 A T 13: 21,520,912 S286T probably benign Het
Other mutations in Pfkfb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Pfkfb4 APN 9 108999134 missense probably damaging 1.00
IGL01978:Pfkfb4 APN 9 109028942 missense probably damaging 1.00
IGL02119:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02121:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02122:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02123:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02125:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02126:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02506:Pfkfb4 APN 9 109030336 missense probably benign 0.00
IGL02881:Pfkfb4 APN 9 109007296 missense probably null 1.00
PIT4466001:Pfkfb4 UTSW 9 108999154 missense probably benign 0.12
PIT4472001:Pfkfb4 UTSW 9 108999154 missense probably benign 0.12
R0087:Pfkfb4 UTSW 9 109007701 missense probably damaging 1.00
R0101:Pfkfb4 UTSW 9 109010643 missense probably benign 0.03
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0379:Pfkfb4 UTSW 9 109027742 splice site probably benign
R0511:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1490:Pfkfb4 UTSW 9 109027620 missense probably damaging 1.00
R1521:Pfkfb4 UTSW 9 109007305 missense probably damaging 1.00
R1932:Pfkfb4 UTSW 9 108999169 missense probably damaging 1.00
R3112:Pfkfb4 UTSW 9 109025042 splice site probably benign
R5470:Pfkfb4 UTSW 9 109027593 missense probably damaging 1.00
R5646:Pfkfb4 UTSW 9 109008421 missense probably damaging 1.00
R5930:Pfkfb4 UTSW 9 109030394 unclassified probably benign
R6139:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R6632:Pfkfb4 UTSW 9 109009562 splice site probably null
R6873:Pfkfb4 UTSW 9 109010335 splice site probably null
R6958:Pfkfb4 UTSW 9 109010547 missense probably damaging 1.00
R7098:Pfkfb4 UTSW 9 108999154 missense probably benign 0.05
R7131:Pfkfb4 UTSW 9 109007302 missense probably benign 0.21
R7148:Pfkfb4 UTSW 9 109027608 missense probably damaging 0.99
R7284:Pfkfb4 UTSW 9 109011240 missense possibly damaging 0.88
R7903:Pfkfb4 UTSW 9 108998951 missense probably damaging 1.00
R7973:Pfkfb4 UTSW 9 109025111 missense probably damaging 1.00
R8506:Pfkfb4 UTSW 9 109005599 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCGTTCAGAAAACCGACAGC -3'
(R):5'- GATTCAAGTCCAGGGGAAACGC -3'

Sequencing Primer
(F):5'- CGACAGCCAGGGACACAG -3'
(R):5'- AGGCCCAGACAGTTCCTTCTG -3'
Posted On2014-10-15