Incidental Mutation 'R2214:Map3k5'
ID241028
Institutional Source Beutler Lab
Gene Symbol Map3k5
Ensembl Gene ENSMUSG00000071369
Gene Namemitogen-activated protein kinase kinase kinase 5
SynonymsASK, ASK1, 7420452D20Rik, Mekk5
MMRRC Submission 040216-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2214 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location19934472-20142753 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 20026289 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095806] [ENSMUST00000120259] [ENSMUST00000129437] [ENSMUST00000152533]
Predicted Effect probably null
Transcript: ENSMUST00000095806
SMART Domains Protein: ENSMUSP00000093485
Gene: ENSMUSG00000071369

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 552 2.1e-162 PFAM
S_TKc 687 945 8.08e-92 SMART
low complexity region 1195 1207 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
coiled coil region 1251 1292 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120259
SMART Domains Protein: ENSMUSP00000112864
Gene: ENSMUSG00000071369

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 544 1.7e-156 PFAM
S_TKc 679 937 8.08e-92 SMART
low complexity region 1187 1199 N/A INTRINSIC
low complexity region 1217 1230 N/A INTRINSIC
coiled coil region 1243 1284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129437
SMART Domains Protein: ENSMUSP00000114518
Gene: ENSMUSG00000071369

DomainStartEndE-ValueType
Pfam:Pkinase 34 144 7.6e-20 PFAM
Pfam:Pkinase_Tyr 34 144 5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152533
SMART Domains Protein: ENSMUSP00000122553
Gene: ENSMUSG00000071369

DomainStartEndE-ValueType
Pfam:DUF4071 10 80 6.3e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are overtly normal, however apoptosis abnormalities are evident in cultured cells and after induced heart damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,108,128 Y516C probably benign Het
Adam22 C T 5: 8,136,805 probably null Het
Akap8l T C 17: 32,338,825 probably null Het
BC003965 T C 17: 25,184,725 V13A probably benign Het
Casr T C 16: 36,515,758 Y63C probably damaging Het
Ccdc178 T C 18: 21,914,990 D781G possibly damaging Het
Col9a1 C A 1: 24,208,202 P168Q probably damaging Het
Dnm2 T C 9: 21,485,723 probably null Het
Dst C T 1: 34,271,401 T6325M probably damaging Het
Ercc4 C A 16: 13,110,024 D19E probably damaging Het
Gm1110 C A 9: 26,902,490 V198L probably benign Het
Gm8674 T A 13: 49,901,360 noncoding transcript Het
Grm7 A T 6: 111,358,997 I790F probably damaging Het
Habp2 A G 19: 56,317,817 D445G possibly damaging Het
Kat7 G A 11: 95,275,805 T517I probably damaging Het
Kbtbd11 T A 8: 15,029,178 D592E possibly damaging Het
Lgals8 T A 13: 12,454,832 Q82L probably benign Het
Lmtk3 A G 7: 45,794,853 probably benign Het
Map2 A T 1: 66,420,186 D1530V probably damaging Het
Map2k6 G A 11: 110,496,341 V180I probably damaging Het
Mtor A G 4: 148,538,870 E2059G probably benign Het
Myh10 A G 11: 68,783,127 D660G probably damaging Het
Myo16 T A 8: 10,438,803 V658E probably damaging Het
Nckap5 A T 1: 126,025,750 S1090T possibly damaging Het
Nhlrc3 T C 3: 53,456,454 H217R probably damaging Het
Ntrk3 T A 7: 78,516,772 I118F probably damaging Het
Olfr1181 C T 2: 88,423,117 V303M probably benign Het
Olfr305 T A 7: 86,364,206 I44F probably benign Het
Olfr389 A T 11: 73,776,829 L166* probably null Het
Paxip1 T C 5: 27,742,501 Y1053C probably damaging Het
Pfkfb4 T A 9: 109,005,609 F117I probably benign Het
Pp2d1 T C 17: 53,515,396 Y214C probably benign Het
Prr7 C A 13: 55,472,800 S207* probably null Het
Ptprh T A 7: 4,552,922 Q715L possibly damaging Het
Rasgrp1 A T 2: 117,285,165 D647E probably damaging Het
Rnf20 T A 4: 49,648,344 M384K possibly damaging Het
Rps6kb1 A T 11: 86,534,070 C37S possibly damaging Het
Serpinb9f C A 13: 33,334,609 T364K probably benign Het
Sorbs1 C T 19: 40,296,631 A641T probably damaging Het
Srrm2 T C 17: 23,816,745 probably benign Het
Stag3 C T 5: 138,301,266 S849L possibly damaging Het
Syt15 A T 14: 34,223,032 S179C probably damaging Het
Tapbp T C 17: 33,920,326 F90L possibly damaging Het
Timm23 A T 14: 32,198,987 D49E probably damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem174 A C 13: 98,637,249 S24R possibly damaging Het
Tmem63a A G 1: 180,961,114 S339G probably benign Het
Tsc22d2 A G 3: 58,416,206 Y173C probably damaging Het
Ubap2 A G 4: 41,199,714 probably null Het
Upp1 T A 11: 9,136,033 V290E probably benign Het
Usp17lb A T 7: 104,841,432 M96K probably benign Het
Wdr20rt A G 12: 65,227,413 E449G probably damaging Het
Zkscan8 A T 13: 21,520,912 S286T probably benign Het
Other mutations in Map3k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Map3k5 APN 10 19935044 missense possibly damaging 0.73
IGL00978:Map3k5 APN 10 20141567 missense probably damaging 1.00
IGL01470:Map3k5 APN 10 20118187 missense possibly damaging 0.89
IGL01992:Map3k5 APN 10 20029133 nonsense probably null
IGL02479:Map3k5 APN 10 20056484 missense probably damaging 1.00
IGL02728:Map3k5 APN 10 20118292 missense possibly damaging 0.71
IGL02812:Map3k5 APN 10 20025036 missense probably damaging 1.00
IGL03104:Map3k5 APN 10 20132055 missense probably benign
P0033:Map3k5 UTSW 10 20132213 splice site probably benign
PIT4434001:Map3k5 UTSW 10 20026257 missense probably damaging 0.98
R0284:Map3k5 UTSW 10 20000613 missense probably damaging 0.99
R1103:Map3k5 UTSW 10 20023676 missense probably benign 0.00
R1172:Map3k5 UTSW 10 20056648 intron probably benign
R1250:Map3k5 UTSW 10 20110775 missense possibly damaging 0.73
R1493:Map3k5 UTSW 10 20029113 missense probably damaging 1.00
R1634:Map3k5 UTSW 10 20136911 missense possibly damaging 0.64
R1693:Map3k5 UTSW 10 20104242 missense probably damaging 1.00
R1713:Map3k5 UTSW 10 20110847 missense possibly damaging 0.79
R1832:Map3k5 UTSW 10 20099560 missense probably damaging 1.00
R1844:Map3k5 UTSW 10 20104163 missense probably benign 0.33
R1869:Map3k5 UTSW 10 20132109 nonsense probably null
R2156:Map3k5 UTSW 10 20024937 missense probably damaging 1.00
R2221:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2223:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2249:Map3k5 UTSW 10 20127697 missense probably damaging 0.99
R2418:Map3k5 UTSW 10 20110857 missense probably benign 0.02
R2513:Map3k5 UTSW 10 20094455 missense possibly damaging 0.92
R3014:Map3k5 UTSW 10 20094429 missense probably damaging 1.00
R3770:Map3k5 UTSW 10 20025019 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20026190 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20140680 missense probably damaging 0.99
R4706:Map3k5 UTSW 10 20058938 missense probably damaging 1.00
R4749:Map3k5 UTSW 10 20132052 missense probably benign 0.42
R4903:Map3k5 UTSW 10 20118489 missense probably null 1.00
R4958:Map3k5 UTSW 10 20023789 missense possibly damaging 0.79
R5065:Map3k5 UTSW 10 20082467 missense probably damaging 1.00
R5210:Map3k5 UTSW 10 20024901 missense possibly damaging 0.82
R5245:Map3k5 UTSW 10 20140691 missense probably benign 0.00
R5304:Map3k5 UTSW 10 20108238 missense probably benign 0.13
R5428:Map3k5 UTSW 10 20023653 missense possibly damaging 0.93
R5566:Map3k5 UTSW 10 20110719 missense probably damaging 1.00
R5914:Map3k5 UTSW 10 20104255 missense probably benign 0.24
R6155:Map3k5 UTSW 10 20118441 missense probably benign 0.01
R6161:Map3k5 UTSW 10 20000575 missense probably damaging 0.98
R6191:Map3k5 UTSW 10 20023669 missense probably damaging 0.99
R6251:Map3k5 UTSW 10 20138260 splice site probably null
R6800:Map3k5 UTSW 10 20141580 makesense probably null
R7304:Map3k5 UTSW 10 20099555 missense probably damaging 1.00
R7722:Map3k5 UTSW 10 20132145 missense probably benign 0.04
RF024:Map3k5 UTSW 10 20100172 missense probably damaging 1.00
X0017:Map3k5 UTSW 10 20118434 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTAACGTTGCGGTTCATCC -3'
(R):5'- CAGGAAAGGCTTTTACTAACAGAGAGA -3'

Sequencing Primer
(F):5'- CTCAGAGTTAGATGCCTGGC -3'
(R):5'- TGAGATACACAGTGAGACCCTGTC -3'
Posted On2014-10-15