Incidental Mutation 'R0165:Rho'
ID 24104
Institutional Source Beutler Lab
Gene Symbol Rho
Ensembl Gene ENSMUSG00000030324
Gene Name rhodopsin
Synonyms opsin 2, Noerg1, Rod Opsin, Long Wavelength Sensitive opsin, LWS opsin, L opsin, Red Opsin, Ops, RP4, Opn2
MMRRC Submission 038441-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R0165 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 6
Chromosomal Location 115908709-115916997 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115909188 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 75 (I75F)
Ref Sequence ENSEMBL: ENSMUSP00000032471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032471] [ENSMUST00000203877] [ENSMUST00000204711] [ENSMUST00000204493]
AlphaFold P15409
Predicted Effect probably damaging
Transcript: ENSMUST00000032471
AA Change: I75F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032471
Gene: ENSMUSG00000030324
AA Change: I75F

DomainStartEndE-ValueType
Pfam:Rhodopsin_N 2 37 1e-23 PFAM
Pfam:7TM_GPCR_Srv 40 323 1.2e-12 PFAM
Pfam:7TM_GPCR_Srw 42 324 7.9e-12 PFAM
Pfam:7TM_GPCR_Srsx 48 321 4.9e-11 PFAM
Pfam:7tm_1 54 306 5.1e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203531
Predicted Effect probably benign
Transcript: ENSMUST00000203877
SMART Domains Protein: ENSMUSP00000144952
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
Pfam:7tm_1 6 147 1.6e-17 PFAM
Pfam:7TM_GPCR_Srw 19 165 1.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 25 162 1.2e-4 PFAM
Pfam:7TM_GPCR_Srv 29 164 7.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203894
Predicted Effect probably benign
Transcript: ENSMUST00000204711
SMART Domains Protein: ENSMUSP00000144768
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
Pfam:7tm_1 1 164 4.1e-24 PFAM
Pfam:7TM_GPCR_Srw 11 182 5.4e-9 PFAM
Pfam:7TM_GPCR_Srv 13 181 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204493
SMART Domains Protein: ENSMUSP00000145464
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
low complexity region 20 41 N/A INTRINSIC
low complexity region 48 54 N/A INTRINSIC
Meta Mutation Damage Score 0.5402 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinitis pigmentosa is an inherited progressive disease which is a major cause of blindness in western communities. It can be inherited as an autosomal dominant, autosomal recessive, or X-linked recessive disorder. In the autosomal dominant form,which comprises about 25% of total cases, approximately 30% of families have mutations in the gene encoding the rod photoreceptor-specific protein rhodopsin. This is the transmembrane protein which, when photoexcited, initiates the visual transduction cascade. Defects in this gene are also one of the causes of congenital stationary night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null homozygotes fail to develop retinal rod outer segments and lose their photoreceptors while heterozygotes exhibit some disorganization of their photoreceptors and a shortening of the outer segments with age. Some point mutants have only light-induced photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,213,924 (GRCm39) I717T possibly damaging Het
6430571L13Rik A G 9: 107,223,383 (GRCm39) probably benign Het
Abca15 T A 7: 119,950,126 (GRCm39) probably benign Het
Abca6 A G 11: 110,110,430 (GRCm39) V573A possibly damaging Het
Adgrl2 A G 3: 148,558,499 (GRCm39) probably benign Het
Agap3 A G 5: 24,684,743 (GRCm39) T544A probably damaging Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Akr1c20 T C 13: 4,573,295 (GRCm39) T7A probably benign Het
Ankrd26 A G 6: 118,517,445 (GRCm39) S459P probably benign Het
Armh4 A G 14: 50,011,243 (GRCm39) S155P probably benign Het
Ascc3 T A 10: 50,718,223 (GRCm39) probably null Het
Brd1 T C 15: 88,613,980 (GRCm39) N305S probably damaging Het
Catip T A 1: 74,407,628 (GRCm39) L320Q possibly damaging Het
Cplane1 G A 15: 8,245,866 (GRCm39) V1413M probably damaging Het
Cttnbp2 G A 6: 18,435,409 (GRCm39) Q150* probably null Het
Cyp2d22 T G 15: 82,257,481 (GRCm39) N228T probably benign Het
Dapk1 T C 13: 60,909,407 (GRCm39) V1340A probably benign Het
Dcaf4 G A 12: 83,582,762 (GRCm39) probably benign Het
Ddhd1 G A 14: 45,833,049 (GRCm39) T849M probably damaging Het
Dnah6 A G 6: 72,998,306 (GRCm39) S3987P probably benign Het
Dst C A 1: 34,193,727 (GRCm39) probably benign Het
Epha2 T C 4: 141,049,203 (GRCm39) probably null Het
Ern2 T C 7: 121,779,002 (GRCm39) T281A probably benign Het
Extl1 A G 4: 134,085,014 (GRCm39) F652S probably damaging Het
Gckr A G 5: 31,484,292 (GRCm39) S541G possibly damaging Het
Gdap1l1 A G 2: 163,293,419 (GRCm39) probably null Het
Gm7535 T C 17: 18,131,437 (GRCm39) probably benign Het
Gmps T A 3: 63,901,375 (GRCm39) I398N probably damaging Het
Igf2r A G 17: 12,917,414 (GRCm39) V1556A probably benign Het
Il3ra T A 14: 14,350,967 (GRCm38) N283K probably benign Het
Ist1 A G 8: 110,401,998 (GRCm39) probably benign Het
Lama3 A T 18: 12,657,867 (GRCm39) I1934F probably damaging Het
Lars1 A T 18: 42,335,762 (GRCm39) M1118K possibly damaging Het
Lpin2 C T 17: 71,553,514 (GRCm39) S846L probably damaging Het
Lrrc4b C A 7: 44,111,739 (GRCm39) T537K probably damaging Het
Ltn1 G A 16: 87,202,407 (GRCm39) probably benign Het
Meiob A G 17: 25,054,135 (GRCm39) T401A probably benign Het
Mettl21e G A 1: 44,250,283 (GRCm39) T41M probably damaging Het
Miga1 C T 3: 151,996,480 (GRCm39) E323K probably damaging Het
Ndufs1 A T 1: 63,198,907 (GRCm39) probably null Het
Or5p62 T C 7: 107,771,882 (GRCm39) D23G probably benign Het
Otog G A 7: 45,953,655 (GRCm39) V2638M probably damaging Het
Parp6 T C 9: 59,540,208 (GRCm39) Y274H probably damaging Het
Prom2 A T 2: 127,381,434 (GRCm39) probably benign Het
Prune2 T A 19: 17,099,974 (GRCm39) M1826K probably benign Het
Qki T A 17: 10,457,892 (GRCm39) D159V probably damaging Het
Rab12 A T 17: 66,807,312 (GRCm39) I139N probably damaging Het
Rab25 T A 3: 88,455,362 (GRCm39) E7D probably benign Het
Rala A T 13: 18,063,174 (GRCm39) V139E probably benign Het
Ralgapa2 A G 2: 146,230,407 (GRCm39) probably benign Het
Rbl2 T A 8: 91,800,804 (GRCm39) Y89N probably damaging Het
Slc38a4 C A 15: 96,906,830 (GRCm39) A303S probably benign Het
Slc6a15 A G 10: 103,245,670 (GRCm39) D551G probably null Het
Smyd3 T C 1: 178,871,437 (GRCm39) N314S probably benign Het
Speer4f1 T A 5: 17,684,512 (GRCm39) L180* probably null Het
Stat6 T C 10: 127,493,096 (GRCm39) V576A probably damaging Het
Strn T C 17: 78,984,803 (GRCm39) D127G possibly damaging Het
Syne1 T C 10: 4,983,096 (GRCm39) R8610G probably benign Het
Tbc1d7 A C 13: 43,306,678 (GRCm39) probably null Het
Tcf3 C T 10: 80,248,831 (GRCm39) R548Q probably damaging Het
Tlr9 C A 9: 106,103,286 (GRCm39) A859D probably benign Het
Tmem106c T A 15: 97,866,020 (GRCm39) probably benign Het
Tmprss11c A T 5: 86,379,786 (GRCm39) probably benign Het
Tnfsf18 A G 1: 161,322,300 (GRCm39) R7G probably benign Het
Tnrc6b T A 15: 80,742,871 (GRCm39) probably null Het
Trpm7 A T 2: 126,639,433 (GRCm39) F1684I probably damaging Het
Ttbk1 C A 17: 46,789,864 (GRCm39) R133L possibly damaging Het
Ttn A G 2: 76,551,686 (GRCm39) S22962P probably damaging Het
Ube2q1 T A 3: 89,683,460 (GRCm39) L135Q probably damaging Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Vwce T C 19: 10,637,337 (GRCm39) probably benign Het
Wdhd1 A G 14: 47,504,525 (GRCm39) S350P probably benign Het
Zbtb21 A G 16: 97,752,604 (GRCm39) S560P probably damaging Het
Other mutations in Rho
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Rho APN 6 115,909,146 (GRCm39) missense probably damaging 0.99
IGL02480:Rho APN 6 115,912,505 (GRCm39) missense probably benign 0.20
IGL02625:Rho APN 6 115,912,158 (GRCm39) missense possibly damaging 0.95
bemr3 UTSW 6 115,912,092 (GRCm39) missense probably damaging 1.00
R1167:Rho UTSW 6 115,912,384 (GRCm39) missense probably damaging 0.98
R1169:Rho UTSW 6 115,909,199 (GRCm39) missense probably damaging 1.00
R1312:Rho UTSW 6 115,912,566 (GRCm39) missense probably damaging 1.00
R2393:Rho UTSW 6 115,912,352 (GRCm39) splice site probably benign
R3895:Rho UTSW 6 115,910,863 (GRCm39) missense probably damaging 1.00
R4414:Rho UTSW 6 115,912,191 (GRCm39) missense probably benign
R4416:Rho UTSW 6 115,912,191 (GRCm39) missense probably benign
R5753:Rho UTSW 6 115,912,448 (GRCm39) missense probably damaging 1.00
R6483:Rho UTSW 6 115,909,218 (GRCm39) missense possibly damaging 0.78
R6552:Rho UTSW 6 115,908,709 (GRCm39) splice site probably null
R6719:Rho UTSW 6 115,910,854 (GRCm39) missense possibly damaging 0.58
R7030:Rho UTSW 6 115,912,504 (GRCm39) missense possibly damaging 0.93
R7354:Rho UTSW 6 115,912,464 (GRCm39) nonsense probably null
R7566:Rho UTSW 6 115,909,135 (GRCm39) missense probably damaging 1.00
R7674:Rho UTSW 6 115,909,294 (GRCm39) missense probably damaging 1.00
R7699:Rho UTSW 6 115,912,200 (GRCm39) missense probably damaging 0.98
R7700:Rho UTSW 6 115,912,200 (GRCm39) missense probably damaging 0.98
R8477:Rho UTSW 6 115,912,346 (GRCm39) splice site probably null
R8745:Rho UTSW 6 115,912,483 (GRCm39) missense probably damaging 1.00
R9783:Rho UTSW 6 115,910,920 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGTGCCCTTCTCCAACGTCACAG -3'
(R):5'- TCAGGGTCACAGTGTTTGCCAATG -3'

Sequencing Primer
(F):5'- TCCAACGTCACAGGCGTG -3'
(R):5'- CCAATGAATAAGCTGGGCCTTTAG -3'
Posted On 2013-04-16