Incidental Mutation 'R2214:Prr7'
ID241040
Institutional Source Beutler Lab
Gene Symbol Prr7
Ensembl Gene ENSMUSG00000034686
Gene Nameproline rich 7 (synaptic)
Synonyms
MMRRC Submission 040216-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R2214 (G1)
Quality Score220
Status Not validated
Chromosome13
Chromosomal Location55464267-55473154 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 55472800 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 207 (S207*)
Ref Sequence ENSEMBL: ENSMUSP00000046776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021950] [ENSMUST00000046533] [ENSMUST00000109921] [ENSMUST00000109923]
Predicted Effect probably benign
Transcript: ENSMUST00000021950
SMART Domains Protein: ENSMUSP00000021950
Gene: ENSMUSG00000034675

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 453 473 N/A INTRINSIC
low complexity region 477 498 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 655 668 N/A INTRINSIC
low complexity region 697 705 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000046533
AA Change: S207*
SMART Domains Protein: ENSMUSP00000046776
Gene: ENSMUSG00000034686
AA Change: S207*

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
low complexity region 63 131 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109921
SMART Domains Protein: ENSMUSP00000105547
Gene: ENSMUSG00000034675

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 407 427 N/A INTRINSIC
low complexity region 431 452 N/A INTRINSIC
low complexity region 456 472 N/A INTRINSIC
low complexity region 573 591 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 652 660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109923
SMART Domains Protein: ENSMUSP00000105549
Gene: ENSMUSG00000034675

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 407 427 N/A INTRINSIC
low complexity region 431 452 N/A INTRINSIC
low complexity region 456 472 N/A INTRINSIC
low complexity region 573 591 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
low complexity region 651 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183653
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no major defects in the immune system except for a slight decrease in the number of single positive CD4+ T cells in the thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,108,128 Y516C probably benign Het
Adam22 C T 5: 8,136,805 probably null Het
Akap8l T C 17: 32,338,825 probably null Het
BC003965 T C 17: 25,184,725 V13A probably benign Het
Casr T C 16: 36,515,758 Y63C probably damaging Het
Ccdc178 T C 18: 21,914,990 D781G possibly damaging Het
Col9a1 C A 1: 24,208,202 P168Q probably damaging Het
Dnm2 T C 9: 21,485,723 probably null Het
Dst C T 1: 34,271,401 T6325M probably damaging Het
Ercc4 C A 16: 13,110,024 D19E probably damaging Het
Gm1110 C A 9: 26,902,490 V198L probably benign Het
Gm8674 T A 13: 49,901,360 noncoding transcript Het
Grm7 A T 6: 111,358,997 I790F probably damaging Het
Habp2 A G 19: 56,317,817 D445G possibly damaging Het
Kat7 G A 11: 95,275,805 T517I probably damaging Het
Kbtbd11 T A 8: 15,029,178 D592E possibly damaging Het
Lgals8 T A 13: 12,454,832 Q82L probably benign Het
Lmtk3 A G 7: 45,794,853 probably benign Het
Map2 A T 1: 66,420,186 D1530V probably damaging Het
Map2k6 G A 11: 110,496,341 V180I probably damaging Het
Map3k5 T A 10: 20,026,289 probably null Het
Mtor A G 4: 148,538,870 E2059G probably benign Het
Myh10 A G 11: 68,783,127 D660G probably damaging Het
Myo16 T A 8: 10,438,803 V658E probably damaging Het
Nckap5 A T 1: 126,025,750 S1090T possibly damaging Het
Nhlrc3 T C 3: 53,456,454 H217R probably damaging Het
Ntrk3 T A 7: 78,516,772 I118F probably damaging Het
Olfr1181 C T 2: 88,423,117 V303M probably benign Het
Olfr305 T A 7: 86,364,206 I44F probably benign Het
Olfr389 A T 11: 73,776,829 L166* probably null Het
Paxip1 T C 5: 27,742,501 Y1053C probably damaging Het
Pfkfb4 T A 9: 109,005,609 F117I probably benign Het
Pp2d1 T C 17: 53,515,396 Y214C probably benign Het
Ptprh T A 7: 4,552,922 Q715L possibly damaging Het
Rasgrp1 A T 2: 117,285,165 D647E probably damaging Het
Rnf20 T A 4: 49,648,344 M384K possibly damaging Het
Rps6kb1 A T 11: 86,534,070 C37S possibly damaging Het
Serpinb9f C A 13: 33,334,609 T364K probably benign Het
Sorbs1 C T 19: 40,296,631 A641T probably damaging Het
Srrm2 T C 17: 23,816,745 probably benign Het
Stag3 C T 5: 138,301,266 S849L possibly damaging Het
Syt15 A T 14: 34,223,032 S179C probably damaging Het
Tapbp T C 17: 33,920,326 F90L possibly damaging Het
Timm23 A T 14: 32,198,987 D49E probably damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem174 A C 13: 98,637,249 S24R possibly damaging Het
Tmem63a A G 1: 180,961,114 S339G probably benign Het
Tsc22d2 A G 3: 58,416,206 Y173C probably damaging Het
Ubap2 A G 4: 41,199,714 probably null Het
Upp1 T A 11: 9,136,033 V290E probably benign Het
Usp17lb A T 7: 104,841,432 M96K probably benign Het
Wdr20rt A G 12: 65,227,413 E449G probably damaging Het
Zkscan8 A T 13: 21,520,912 S286T probably benign Het
Other mutations in Prr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7460:Prr7 UTSW 13 55472353 missense unknown
R7622:Prr7 UTSW 13 55472796 missense probably benign 0.00
R7627:Prr7 UTSW 13 55472334 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AATCGGACATGTCTAAGCCGC -3'
(R):5'- AGGGTAAGAAATCCCTCCCTC -3'

Sequencing Primer
(F):5'- ATGTCTAAGCCGCCGTGCTAC -3'
(R):5'- TTTAAAAAGCCTCGCAGTCAGG -3'
Posted On2014-10-15