Incidental Mutation 'R2215:Pld1'
ID241067
Institutional Source Beutler Lab
Gene Symbol Pld1
Ensembl Gene ENSMUSG00000027695
Gene Namephospholipase D1
SynonymsPld1a, Pld1b
MMRRC Submission 040217-MU
Accession Numbers

Genbank: NM_001164056; MGI: 109585

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2215 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location27938695-28133362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28078393 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 577 (I577F)
Ref Sequence ENSEMBL: ENSMUSP00000113810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067757] [ENSMUST00000120834] [ENSMUST00000123539]
Predicted Effect probably benign
Transcript: ENSMUST00000067757
AA Change: I577F

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695
AA Change: I577F

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120834
AA Change: I577F

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113810
Gene: ENSMUSG00000027695
AA Change: I577F

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123539
AA Change: I577F
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695
AA Change: I577F

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131842
Predicted Effect unknown
Transcript: ENSMUST00000148827
AA Change: I388F
SMART Domains Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695
AA Change: I388F

DomainStartEndE-ValueType
PH 32 142 5.71e-9 SMART
PLDc 271 298 6.6e-6 SMART
low complexity region 315 329 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
PLDc 665 715 2.5e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195622
Meta Mutation Damage Score 0.0905 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylcholine-specific phospholipase which catalyzes the hydrolysis of phosphatidylcholine in order to yield phosphatidic acid and choline. The enzyme may play a role in signal transduction and subcellular trafficking. Alternative splicing results in multiple transcript variants with both catalytic and regulatory properties. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a null allele show reduced tumor growth and angiogenesis. Homozygotes for a second null allele show abnormal hepatic autophagy after food restriction. Homozygotes for a third null allele show altered platelet activation and protection from thrombosis and ischemic brain injury. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef12 G T 9: 43,005,871 H391N probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Bmp8a C T 4: 123,325,118 V166I probably benign Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L3S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Dach1 A G 14: 98,168,481 probably null Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Ep400 A T 5: 110,693,555 probably benign Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Fbxo31 T C 8: 121,566,311 I112V probably benign Het
Galntl5 A T 5: 25,198,478 N149I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Igf1r T A 7: 68,165,234 D294E probably benign Het
Kdm6b G A 11: 69,405,044 P799L unknown Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Myh2 T C 11: 67,191,737 W1378R probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr503 T C 7: 108,544,888 L119P probably damaging Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 probably benign Het
Plekhm1 A T 11: 103,376,985 I720N probably damaging Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Sppl2a G T 2: 126,927,834 T34K probably benign Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Pld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Pld1 APN 3 28045098 critical splice donor site probably null
IGL01090:Pld1 APN 3 28088667 missense probably benign 0.01
IGL01140:Pld1 APN 3 28078237 missense probably benign 0.01
IGL01646:Pld1 APN 3 28099664 missense probably damaging 1.00
IGL01830:Pld1 APN 3 28048004 splice site probably benign
IGL01946:Pld1 APN 3 28124617 missense probably damaging 1.00
IGL02139:Pld1 APN 3 28120812 missense probably damaging 0.98
IGL02189:Pld1 APN 3 28120783 missense probably benign 0.03
IGL02476:Pld1 APN 3 28048039 missense probably damaging 1.00
IGL02540:Pld1 APN 3 28029160 unclassified probably benign
IGL02649:Pld1 APN 3 28087229 missense probably damaging 0.98
IGL02720:Pld1 APN 3 28087262 missense probably damaging 1.00
IGL02831:Pld1 APN 3 28076425 missense probably damaging 0.99
IGL02953:Pld1 APN 3 28112247 missense probably benign 0.03
IGL03005:Pld1 APN 3 28087253 missense possibly damaging 0.78
IGL03251:Pld1 APN 3 28088665 missense probably benign 0.06
IGL03331:Pld1 APN 3 28085845 missense probably damaging 1.00
A9681:Pld1 UTSW 3 28085832 missense probably benign 0.01
IGL03134:Pld1 UTSW 3 28029167 missense probably benign 0.01
P0023:Pld1 UTSW 3 28048125 missense probably damaging 1.00
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0282:Pld1 UTSW 3 28078273 missense probably benign
R0372:Pld1 UTSW 3 28088638 splice site probably null
R0454:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R0492:Pld1 UTSW 3 28109817 missense probably damaging 0.96
R0505:Pld1 UTSW 3 28120822 missense possibly damaging 0.69
R0667:Pld1 UTSW 3 28079178 splice site probably null
R0678:Pld1 UTSW 3 28120784 missense probably damaging 0.99
R0980:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R1200:Pld1 UTSW 3 28049286 missense probably damaging 1.00
R1235:Pld1 UTSW 3 28028734 missense probably benign 0.05
R1657:Pld1 UTSW 3 28071187 missense probably benign 0.04
R1670:Pld1 UTSW 3 28049240 missense probably benign 0.17
R1705:Pld1 UTSW 3 28071277 critical splice donor site probably null
R1815:Pld1 UTSW 3 28109768 missense probably benign 0.04
R3435:Pld1 UTSW 3 28124623 missense probably benign 0.13
R3522:Pld1 UTSW 3 28031247 missense probably damaging 1.00
R4206:Pld1 UTSW 3 28120783 missense probably benign 0.03
R4553:Pld1 UTSW 3 28124702 missense probably benign
R4612:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R4623:Pld1 UTSW 3 28029244 missense probably benign 0.01
R4840:Pld1 UTSW 3 28076551 missense probably benign 0.10
R4869:Pld1 UTSW 3 28109802 missense possibly damaging 0.84
R4982:Pld1 UTSW 3 28031298 missense probably damaging 0.97
R5087:Pld1 UTSW 3 28124582 missense probably damaging 1.00
R5182:Pld1 UTSW 3 28045081 missense probably damaging 1.00
R5384:Pld1 UTSW 3 28025320 missense probably damaging 1.00
R6243:Pld1 UTSW 3 28095805 missense probably damaging 0.98
R6345:Pld1 UTSW 3 28130747 intron probably benign
R6692:Pld1 UTSW 3 28041199 missense probably benign 0.15
R6881:Pld1 UTSW 3 28078414 missense possibly damaging 0.77
R7197:Pld1 UTSW 3 28024252 missense probably damaging 1.00
R7267:Pld1 UTSW 3 28076401 missense probably damaging 1.00
R7284:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R7293:Pld1 UTSW 3 28087286 missense probably damaging 0.99
R7440:Pld1 UTSW 3 28041270 missense probably benign 0.01
R7524:Pld1 UTSW 3 28024321 missense possibly damaging 0.77
R7747:Pld1 UTSW 3 28087189 missense possibly damaging 0.66
R7882:Pld1 UTSW 3 28045009 missense probably damaging 1.00
R7965:Pld1 UTSW 3 28045009 missense probably damaging 1.00
R8033:Pld1 UTSW 3 28029210 missense probably benign 0.02
Z1088:Pld1 UTSW 3 28029243 missense probably benign
Z1176:Pld1 UTSW 3 28076533 missense probably damaging 1.00
Z1176:Pld1 UTSW 3 28131577 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTACCATTTGTAAACTACCACTTAG -3'
(R):5'- GTGCCATGATGTCACACAGG -3'

Sequencing Primer
(F):5'- TTCTCAGGCAGCATCAGTAG -3'
(R):5'- CCATGATGTCACACAGGATGCATG -3'
Posted On2014-10-15