Mutagenetix > Incidental Mutation

Incidental Mutation 'R2215:Pld1'

241067

Institutional Source

Beutler Lab

Gene Symbol

Pld1

Ensembl Gene

ENSMUSG00000027695

Gene Name

phospholipase D1

Synonyms

Pld1a, Pld1b

MMRRC Submission

040217-MU

Accession Numbers

Genbank: NM_001164056; MGI: 109585

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2215 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27938695-28133362 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 28078393 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 577 (I577F)

Ref Sequence

ENSEMBL: ENSMUSP00000113810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067757] [ENSMUST00000120834] [ENSMUST00000123539]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000067757
AA Change: I577F

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695
AA Change: I577F

Domain	Start	End	E-Value	Type
PX	79	209	7.97e-25	SMART
PH	220	330	5.71e-9	SMART
PLDc	459	486	6.6e-6	SMART
low complexity region	503	517	N/A	INTRINSIC
low complexity region	575	589	N/A	INTRINSIC
PLDc	853	880	1.34e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120834
AA Change: I577F

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000113810
Gene: ENSMUSG00000027695
AA Change: I577F

Domain	Start	End	E-Value	Type
PX	79	209	7.97e-25	SMART
PH	220	330	5.71e-9	SMART
PLDc	459	486	6.6e-6	SMART
low complexity region	503	517	N/A	INTRINSIC
low complexity region	575	589	N/A	INTRINSIC
PLDc	853	880	1.34e-6	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000123539
AA Change: I577F

SMART Domains

Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695
AA Change: I577F

Domain	Start	End	E-Value	Type
PX	79	209	7.97e-25	SMART
PH	220	330	5.71e-9	SMART
PLDc	459	486	6.6e-6	SMART
low complexity region	503	517	N/A	INTRINSIC
low complexity region	575	586	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131842

Predicted Effect

unknown
Transcript: ENSMUST00000148827
AA Change: I388F

SMART Domains

Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695
AA Change: I388F

Domain	Start	End	E-Value	Type
PH	32	142	5.71e-9	SMART
PLDc	271	298	6.6e-6	SMART
low complexity region	315	329	N/A	INTRINSIC
low complexity region	387	401	N/A	INTRINSIC
PLDc	665	715	2.5e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195622

Meta Mutation Damage Score

0.0905

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylcholine-specific phospholipase which catalyzes the hydrolysis of phosphatidylcholine in order to yield phosphatidic acid and choline. The enzyme may play a role in signal transduction and subcellular trafficking. Alternative splicing results in multiple transcript variants with both catalytic and regulatory properties. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a null allele show reduced tumor growth and angiogenesis. Homozygotes for a second null allele show abnormal hepatic autophagy after food restriction. Homozygotes for a third null allele show altered platelet activation and protection from thrombosis and ischemic brain injury. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	A	11: 84,363,793	S1899T	probably damaging	Het
Accs	G	T	2: 93,841,898	N208K	probably benign	Het
Actn4	C	A	7: 28,918,753	V22L	possibly damaging	Het
Adam21	A	G	12: 81,560,290	S233P	probably damaging	Het
Agmat	C	T	4: 141,749,588	R102C	probably benign	Het
Akap8l	T	C	17: 32,321,595	E608G	possibly damaging	Het
Arap2	T	C	5: 62,677,176	I788V	probably damaging	Het
Arhgef12	G	T	9: 43,005,871	H391N	probably damaging	Het
Arhgef28	G	T	13: 98,051,021	H255Q	possibly damaging	Het
Baz1a	G	A	12: 54,975,369	R43*	probably null	Het
Bcas3	T	C	11: 85,801,943	S862P	probably damaging	Het
Blm	A	T	7: 80,499,847	H671Q	possibly damaging	Het
Bmp8a	C	T	4: 123,325,118	V166I	probably benign	Het
Cep120	G	T	18: 53,727,635	P241Q	probably damaging	Het
Col14a1	G	A	15: 55,380,842	G437E	unknown	Het
Cyp2a5	T	C	7: 26,840,475	L3S	probably damaging	Het
D16Ertd472e	T	C	16: 78,545,267	T242A	probably benign	Het
Dach1	A	G	14: 98,168,481		probably null	Het
Ddx20	A	T	3: 105,680,340		probably benign	Het
Eif4enif1	A	G	11: 3,227,476	S185G	probably damaging	Het
Ep400	A	T	5: 110,693,555		probably benign	Het
Fam117b	T	A	1: 59,969,060	I351K	probably damaging	Het
Fbxo31	T	C	8: 121,566,311	I112V	probably benign	Het
Galntl5	A	T	5: 25,198,478	N149I	probably damaging	Het
Gja8	A	T	3: 96,919,902	F148Y	probably damaging	Het
Gm9774	G	A	3: 92,428,423	A324V	probably damaging	Het
Gpatch1	A	T	7: 35,293,827	L531Q	possibly damaging	Het
Gprin1	G	A	13: 54,740,233	T76M	probably damaging	Het
Htr4	T	A	18: 62,413,716	C113*	probably null	Het
Igf1r	T	A	7: 68,165,234	D294E	probably benign	Het
Kdm6b	G	A	11: 69,405,044	P799L	unknown	Het
Lat	A	T	7: 126,367,965	V139E	probably damaging	Het
Lrrc34	G	A	3: 30,643,529	R51C	probably benign	Het
Map3k1	A	G	13: 111,755,788	S978P	probably benign	Het
Masp1	T	A	16: 23,452,521	D659V	possibly damaging	Het
Mcam	A	T	9: 44,139,953	R415*	probably null	Het
Mtmr10	A	G	7: 64,337,655	T648A	probably benign	Het
Myh2	T	C	11: 67,191,737	W1378R	probably benign	Het
Nipsnap2	A	G	5: 129,739,585	E64G	probably damaging	Het
Olfr1240	T	C	2: 89,440,037	M81V	probably benign	Het
Olfr1412	G	A	1: 92,588,986	V219I	probably benign	Het
Olfr503	T	C	7: 108,544,888	L119P	probably damaging	Het
Olfr788	A	T	10: 129,473,420	I243F	probably damaging	Het
Pcdhb8	T	G	18: 37,357,074	S602A	probably damaging	Het
Peg10	A	T	6: 4,756,918		probably benign	Het
Plekhm1	A	T	11: 103,376,985	I720N	probably damaging	Het
Ppp2r1a	A	G	17: 20,961,743		probably null	Het
Retreg3	G	T	11: 101,119,633	Y49*	probably null	Het
Rrp36	T	C	17: 46,672,820	E22G	possibly damaging	Het
Sec14l2	C	A	11: 4,109,169	A167S	probably damaging	Het
Sema5b	A	G	16: 35,660,215	T751A	probably damaging	Het
Smarcc1	C	A	9: 110,237,839		probably benign	Het
Smox	T	C	2: 131,520,270		probably null	Het
Spats2l	A	T	1: 57,946,416	T543S	possibly damaging	Het
Sppl2a	G	T	2: 126,927,834	T34K	probably benign	Het
Svep1	T	C	4: 58,138,602		probably benign	Het
Tet2	T	A	3: 133,486,601	I691F	probably benign	Het
Tnxb	T	C	17: 34,704,140	Y2566H	possibly damaging	Het
Ttn	T	C	2: 76,740,509	E26680G	probably damaging	Het
Txlna	T	C	4: 129,639,318	E139G	possibly damaging	Het
Ubap2	T	C	4: 41,196,483		probably null	Het
Ubr3	A	T	2: 69,979,317		probably null	Het
Usp37	A	C	1: 74,444,526	F844V	probably damaging	Het
Usp6nl	A	G	2: 6,424,339	D204G	probably damaging	Het
Vmn1r230	T	C	17: 20,847,422	I291T	probably benign	Het
Zfp229	T	G	17: 21,746,277	V496G	possibly damaging	Het

Other mutations in Pld1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Pld1	APN	3	28045098	critical splice donor site	probably null
IGL01090:Pld1	APN	3	28088667	missense	probably benign	0.01
IGL01140:Pld1	APN	3	28078237	missense	probably benign	0.01
IGL01646:Pld1	APN	3	28099664	missense	probably damaging	1.00
IGL01830:Pld1	APN	3	28048004	splice site	probably benign
IGL01946:Pld1	APN	3	28124617	missense	probably damaging	1.00
IGL02139:Pld1	APN	3	28120812	missense	probably damaging	0.98
IGL02189:Pld1	APN	3	28120783	missense	probably benign	0.03
IGL02476:Pld1	APN	3	28048039	missense	probably damaging	1.00
IGL02540:Pld1	APN	3	28029160	unclassified	probably benign
IGL02649:Pld1	APN	3	28087229	missense	probably damaging	0.98
IGL02720:Pld1	APN	3	28087262	missense	probably damaging	1.00
IGL02831:Pld1	APN	3	28076425	missense	probably damaging	0.99
IGL02953:Pld1	APN	3	28112247	missense	probably benign	0.03
IGL03005:Pld1	APN	3	28087253	missense	possibly damaging	0.78
IGL03251:Pld1	APN	3	28088665	missense	probably benign	0.06
IGL03331:Pld1	APN	3	28085845	missense	probably damaging	1.00
A9681:Pld1	UTSW	3	28085832	missense	probably benign	0.01
IGL03134:Pld1	UTSW	3	28029167	missense	probably benign	0.01
P0023:Pld1	UTSW	3	28048125	missense	probably damaging	1.00
R0054:Pld1	UTSW	3	28095884	splice site	probably benign
R0054:Pld1	UTSW	3	28095884	splice site	probably benign
R0282:Pld1	UTSW	3	28078273	missense	probably benign
R0372:Pld1	UTSW	3	28088638	splice site	probably null
R0454:Pld1	UTSW	3	28124575	missense	probably damaging	1.00
R0492:Pld1	UTSW	3	28109817	missense	probably damaging	0.96
R0505:Pld1	UTSW	3	28120822	missense	possibly damaging	0.69
R0667:Pld1	UTSW	3	28079178	splice site	probably null
R0678:Pld1	UTSW	3	28120784	missense	probably damaging	0.99
R0980:Pld1	UTSW	3	28124575	missense	probably damaging	1.00
R1200:Pld1	UTSW	3	28049286	missense	probably damaging	1.00
R1235:Pld1	UTSW	3	28028734	missense	probably benign	0.05
R1657:Pld1	UTSW	3	28071187	missense	probably benign	0.04
R1670:Pld1	UTSW	3	28049240	missense	probably benign	0.17
R1705:Pld1	UTSW	3	28071277	critical splice donor site	probably null
R1815:Pld1	UTSW	3	28109768	missense	probably benign	0.04
R3435:Pld1	UTSW	3	28124623	missense	probably benign	0.13
R3522:Pld1	UTSW	3	28031247	missense	probably damaging	1.00
R4206:Pld1	UTSW	3	28120783	missense	probably benign	0.03
R4553:Pld1	UTSW	3	28124702	missense	probably benign
R4612:Pld1	UTSW	3	28131733	missense	possibly damaging	0.92
R4623:Pld1	UTSW	3	28029244	missense	probably benign	0.01
R4840:Pld1	UTSW	3	28076551	missense	probably benign	0.10
R4869:Pld1	UTSW	3	28109802	missense	possibly damaging	0.84
R4982:Pld1	UTSW	3	28031298	missense	probably damaging	0.97
R5087:Pld1	UTSW	3	28124582	missense	probably damaging	1.00
R5182:Pld1	UTSW	3	28045081	missense	probably damaging	1.00
R5384:Pld1	UTSW	3	28025320	missense	probably damaging	1.00
R6243:Pld1	UTSW	3	28095805	missense	probably damaging	0.98
R6345:Pld1	UTSW	3	28130747	intron	probably benign
R6692:Pld1	UTSW	3	28041199	missense	probably benign	0.15
R6881:Pld1	UTSW	3	28078414	missense	possibly damaging	0.77
R7197:Pld1	UTSW	3	28024252	missense	probably damaging	1.00
R7267:Pld1	UTSW	3	28076401	missense	probably damaging	1.00
R7284:Pld1	UTSW	3	28131733	missense	possibly damaging	0.92
R7293:Pld1	UTSW	3	28087286	missense	probably damaging	0.99
R7440:Pld1	UTSW	3	28041270	missense	probably benign	0.01
R7524:Pld1	UTSW	3	28024321	missense	possibly damaging	0.77
R7747:Pld1	UTSW	3	28087189	missense	possibly damaging	0.66
R7882:Pld1	UTSW	3	28045009	missense	probably damaging	1.00
R7936:Pld1	UTSW	3	28076502	missense	probably damaging	1.00
R8033:Pld1	UTSW	3	28029210	missense	probably benign	0.02
R8269:Pld1	UTSW	3	28025239	missense	probably benign	0.17
R8316:Pld1	UTSW	3	28024212	missense	probably benign
R8427:Pld1	UTSW	3	28088646	missense	probably damaging	0.97
R8523:Pld1	UTSW	3	28085876	missense	probably damaging	1.00
R8832:Pld1	UTSW	3	28123697	missense
R8850:Pld1	UTSW	3	28112290	missense	possibly damaging	0.88
R9143:Pld1	UTSW	3	28078494	intron	probably benign
R9549:Pld1	UTSW	3	28071232	missense	possibly damaging	0.89
R9648:Pld1	UTSW	3	28120751	missense	probably damaging	0.99
Z1088:Pld1	UTSW	3	28029243	missense	probably benign
Z1176:Pld1	UTSW	3	28076533	missense	probably damaging	1.00
Z1176:Pld1	UTSW	3	28131577	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCTACCATTTGTAAACTACCACTTAG -3'
(R):5'- GTGCCATGATGTCACACAGG -3'

Sequencing Primer
(F):5'- TTCTCAGGCAGCATCAGTAG -3'
(R):5'- CCATGATGTCACACAGGATGCATG -3'

Posted On

2014-10-15