Incidental Mutation 'R2215:Bmp8a'
ID241076
Institutional Source Beutler Lab
Gene Symbol Bmp8a
Ensembl Gene ENSMUSG00000032726
Gene Namebone morphogenetic protein 8a
Synonymsosteogenic protein 2, OP2, Bmp7r1
MMRRC Submission 040217-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R2215 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location123312645-123343252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123325118 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 166 (V166I)
Ref Sequence ENSEMBL: ENSMUSP00000099701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040496] [ENSMUST00000102640] [ENSMUST00000102641]
Predicted Effect probably benign
Transcript: ENSMUST00000040496
AA Change: V166I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037779
Gene: ENSMUSG00000032726
AA Change: V166I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TGFb_propeptide 27 248 3.1e-67 PFAM
low complexity region 250 271 N/A INTRINSIC
TGFB 298 412 2.18e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102640
SMART Domains Protein: ENSMUSP00000099700
Gene: ENSMUSG00000076436

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
CoA_trans 43 272 2.17e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102641
AA Change: V166I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099701
Gene: ENSMUSG00000032726
AA Change: V166I

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 11 248 2e-57 PFAM
low complexity region 250 271 N/A INTRINSIC
TGFB 298 399 2e-68 SMART
Meta Mutation Damage Score 0.1137 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in development of the reproductive system. Mice lacking a functional copy of this gene exhibit degeneration of germ cells and the epididymal epithelium. This gene may have arose from a gene duplication event and its gene duplicate is also present on chromosome 4. [provided by RefSeq, Jul 2016]
PHENOTYPE: About half of the males homozygous for targeted mutations of this gene show spermatogenesis defects and germ cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef12 G T 9: 43,005,871 H391N probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L3S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Dach1 A G 14: 98,168,481 probably null Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Ep400 A T 5: 110,693,555 probably benign Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Fbxo31 T C 8: 121,566,311 I112V probably benign Het
Galntl5 A T 5: 25,198,478 N149I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Igf1r T A 7: 68,165,234 D294E probably benign Het
Kdm6b G A 11: 69,405,044 P799L unknown Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Myh2 T C 11: 67,191,737 W1378R probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr503 T C 7: 108,544,888 L119P probably damaging Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 probably benign Het
Pld1 A T 3: 28,078,393 I577F probably benign Het
Plekhm1 A T 11: 103,376,985 I720N probably damaging Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Sppl2a G T 2: 126,927,834 T34K probably benign Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Bmp8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Bmp8a APN 4 123313301 missense probably damaging 1.00
IGL01816:Bmp8a APN 4 123316397 missense probably damaging 1.00
IGL02423:Bmp8a APN 4 123316427 missense possibly damaging 0.75
leanmean UTSW 4 123313301 missense probably damaging 1.00
R0437:Bmp8a UTSW 4 123316897 missense probably benign 0.28
R0540:Bmp8a UTSW 4 123315930 missense probably damaging 1.00
R1443:Bmp8a UTSW 4 123316965 missense possibly damaging 0.89
R1791:Bmp8a UTSW 4 123324585 missense possibly damaging 0.91
R1832:Bmp8a UTSW 4 123325092 splice site probably benign
R4502:Bmp8a UTSW 4 123342399 missense probably damaging 1.00
R4803:Bmp8a UTSW 4 123324569 missense possibly damaging 0.94
R5179:Bmp8a UTSW 4 123313301 missense probably damaging 1.00
R5350:Bmp8a UTSW 4 123313295 missense probably damaging 1.00
R6166:Bmp8a UTSW 4 123324678 missense probably benign 0.03
R6853:Bmp8a UTSW 4 123342683 missense unknown
R6982:Bmp8a UTSW 4 123325141 missense probably damaging 1.00
R7304:Bmp8a UTSW 4 123342389 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CTCAGTGCTGTGACCTAGTG -3'
(R):5'- CTTTGTCTTCCAGTGGAACGC -3'

Sequencing Primer
(F):5'- GTGACAGGGCAGGAGTTCC -3'
(R):5'- CGACCGTACCCTGGGCTAC -3'
Posted On2014-10-15