Incidental Mutation 'R2215:Ep400'
ID 241082
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene Name E1A binding protein p400
Synonyms mDomino, 1700020J09Rik, p400
MMRRC Submission 040217-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2215 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 110664373-110770717 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 110693555 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: L1732M
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: L1732M

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104066
Predicted Effect probably benign
Transcript: ENSMUST00000112435
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: L1696M
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: L1696M

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125325
SMART Domains Protein: ENSMUSP00000116137
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 107 117 N/A INTRINSIC
low complexity region 223 239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141986
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef12 G T 9: 43,005,871 H391N probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Bmp8a C T 4: 123,325,118 V166I probably benign Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L3S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Dach1 A G 14: 98,168,481 probably null Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Fbxo31 T C 8: 121,566,311 I112V probably benign Het
Galntl5 A T 5: 25,198,478 N149I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Igf1r T A 7: 68,165,234 D294E probably benign Het
Kdm6b G A 11: 69,405,044 P799L unknown Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Myh2 T C 11: 67,191,737 W1378R probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr503 T C 7: 108,544,888 L119P probably damaging Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 probably benign Het
Pld1 A T 3: 28,078,393 I577F probably benign Het
Plekhm1 A T 11: 103,376,985 I720N probably damaging Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Sppl2a G T 2: 126,927,834 T34K probably benign Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0243:Ep400 UTSW 5 110724407 splice site probably benign
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1774:Ep400 UTSW 5 110685491 missense unknown
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2064:Ep400 UTSW 5 110735404 unclassified probably benign
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 splice site probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110698812 missense unknown
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 splice site probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5931:Ep400 UTSW 5 110735520 unclassified probably benign
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6145:Ep400 UTSW 5 110756703 missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110670942 missense probably damaging 1.00
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense unknown
R7272:Ep400 UTSW 5 110755645 nonsense probably null
R7365:Ep400 UTSW 5 110719614 missense unknown
R7581:Ep400 UTSW 5 110756025 missense unknown
R7684:Ep400 UTSW 5 110697352 missense unknown
R7699:Ep400 UTSW 5 110696032 missense unknown
R7700:Ep400 UTSW 5 110696032 missense unknown
R7856:Ep400 UTSW 5 110666584 missense probably damaging 0.99
R7954:Ep400 UTSW 5 110668733 missense possibly damaging 0.46
R8098:Ep400 UTSW 5 110693251 missense unknown
R8108:Ep400 UTSW 5 110687883 missense unknown
R8260:Ep400 UTSW 5 110755612 nonsense probably null
R8293:Ep400 UTSW 5 110708892 missense unknown
R8314:Ep400 UTSW 5 110755753 missense unknown
R8351:Ep400 UTSW 5 110739334 missense probably damaging 1.00
R8424:Ep400 UTSW 5 110693278 missense unknown
R8459:Ep400 UTSW 5 110708891 missense unknown
R8529:Ep400 UTSW 5 110719236 missense unknown
R8688:Ep400 UTSW 5 110720819 missense unknown
R8744:Ep400 UTSW 5 110742059 missense unknown
R8923:Ep400 UTSW 5 110683998 missense unknown
R9005:Ep400 UTSW 5 110711093 missense unknown
R9087:Ep400 UTSW 5 110667564 nonsense probably null
R9146:Ep400 UTSW 5 110701769 nonsense probably null
R9383:Ep400 UTSW 5 110685485 missense unknown
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Z1176:Ep400 UTSW 5 110756635 missense unknown
Z1177:Ep400 UTSW 5 110683364 missense unknown
Z1177:Ep400 UTSW 5 110733743 missense unknown
Z1188:Ep400 UTSW 5 110755683 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTCTAACTTCCCTGAGAAAGAGAG -3'
(R):5'- GCTGCTTGTCTGACAACTCAC -3'

Sequencing Primer
(F):5'- GAGAGAGAATGTCTATCTTGCATTC -3'
(R):5'- ATTTCTGCTCCTCAGGGT -3'
Posted On 2014-10-15