Incidental Mutation 'R2215:Igf1r'
ID 241090
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms line 186, A330103N21Rik, CD221, hyft, IGF-1R
MMRRC Submission 040217-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2215 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 67952827-68233668 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 68165234 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 294 (D294E)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005671
AA Change: D294E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: D294E

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207621
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef12 G T 9: 43,005,871 H391N probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Bmp8a C T 4: 123,325,118 V166I probably benign Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L3S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Dach1 A G 14: 98,168,481 probably null Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Ep400 A T 5: 110,693,555 probably benign Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Fbxo31 T C 8: 121,566,311 I112V probably benign Het
Galntl5 A T 5: 25,198,478 N149I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Kdm6b G A 11: 69,405,044 P799L unknown Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Myh2 T C 11: 67,191,737 W1378R probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr503 T C 7: 108,544,888 L119P probably damaging Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 probably benign Het
Pld1 A T 3: 28,078,393 I577F probably benign Het
Plekhm1 A T 11: 103,376,985 I720N probably damaging Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Sppl2a G T 2: 126,927,834 T34K probably benign Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Hungarian UTSW 7 68214997 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Romanian UTSW 7 68004137 missense possibly damaging 0.94
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7923:Igf1r UTSW 7 68190101 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
R8368:Igf1r UTSW 7 68187048 missense probably benign 0.03
R8458:Igf1r UTSW 7 68195629 missense probably benign
R8539:Igf1r UTSW 7 68003848 missense probably benign 0.06
R8704:Igf1r UTSW 7 68170054 splice site probably benign
R8746:Igf1r UTSW 7 68214997 missense probably damaging 1.00
R8829:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8832:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8859:Igf1r UTSW 7 68183463 missense possibly damaging 0.75
R9057:Igf1r UTSW 7 68183438 missense probably damaging 1.00
R9243:Igf1r UTSW 7 68212027 missense probably benign 0.11
R9342:Igf1r UTSW 7 68194998 missense probably benign 0.00
R9412:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R9525:Igf1r UTSW 7 68214934 missense probably damaging 1.00
R9727:Igf1r UTSW 7 68207806 missense probably damaging 1.00
R9730:Igf1r UTSW 7 68189675 missense probably damaging 1.00
R9779:Igf1r UTSW 7 68004317 missense probably damaging 1.00
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Z1186:Igf1r UTSW 7 68226168 small insertion probably benign
Z1186:Igf1r UTSW 7 68226169 small insertion probably benign
Z1186:Igf1r UTSW 7 68226174 small insertion probably benign
Z1186:Igf1r UTSW 7 68226180 small insertion probably benign
Z1186:Igf1r UTSW 7 68226182 small insertion probably benign
Z1191:Igf1r UTSW 7 68226169 small insertion probably benign
Z1191:Igf1r UTSW 7 68226170 small insertion probably benign
Z1191:Igf1r UTSW 7 68226173 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGAACAACGAGTGCTGCCAC -3'
(R):5'- GATTCGCATTAAAACAAGCTCAGCC -3'

Sequencing Primer
(F):5'- AGTGCTGCCACCCGGAG -3'
(R):5'- AGCTCAGCCATCACCCTCTG -3'
Posted On 2014-10-15