Incidental Mutation 'R2215:Arhgef12'
ID241096
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene NameRho guanine nucleotide exchange factor (GEF) 12
SynonymsLARG, 2310014B11Rik
MMRRC Submission 040217-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R2215 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42963842-43107239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43005871 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 391 (H391N)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
Predicted Effect probably damaging
Transcript: ENSMUST00000072767
AA Change: H390N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: H390N

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165665
AA Change: H391N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: H391N

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Meta Mutation Damage Score 0.5356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Bmp8a C T 4: 123,325,118 V166I probably benign Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L3S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Dach1 A G 14: 98,168,481 probably null Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Ep400 A T 5: 110,693,555 probably benign Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Fbxo31 T C 8: 121,566,311 I112V probably benign Het
Galntl5 A T 5: 25,198,478 N149I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Igf1r T A 7: 68,165,234 D294E probably benign Het
Kdm6b G A 11: 69,405,044 P799L unknown Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Myh2 T C 11: 67,191,737 W1378R probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr503 T C 7: 108,544,888 L119P probably damaging Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 probably benign Het
Pld1 A T 3: 28,078,393 I577F probably benign Het
Plekhm1 A T 11: 103,376,985 I720N probably damaging Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Sppl2a G T 2: 126,927,834 T34K probably benign Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 43020624 missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42982000 missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42990055 missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 43022841 missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42972267 missense probably benign
IGL02135:Arhgef12 APN 9 42972165 missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 43001452 missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42982043 missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42992563 missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 43005623 missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 43005904 nonsense probably null
IGL02803:Arhgef12 APN 9 42972028 missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 43000972 missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 43015920 missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42999077 missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 43026228 missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42974570 missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42992533 splice site probably benign
IGL03398:Arhgef12 APN 9 42978226 missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42978233 missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 43005594 missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42972004 missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42970990 splice site probably null
R0658:Arhgef12 UTSW 9 42981985 missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42993028 missense probably benign 0.02
R0693:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42972381 missense probably benign 0.00
R1147:Arhgef12 UTSW 9 43044256 unclassified probably benign
R1395:Arhgef12 UTSW 9 43005870 missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 43027220 missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42992578 splice site probably benign
R1458:Arhgef12 UTSW 9 42988998 missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42997660 missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 43020717 makesense probably null
R1773:Arhgef12 UTSW 9 43005542 critical splice donor site probably null
R1895:Arhgef12 UTSW 9 43005856 missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42979472 missense possibly damaging 0.75
R2421:Arhgef12 UTSW 9 43001006 missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42972274 missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 43018349 nonsense probably null
R4327:Arhgef12 UTSW 9 42975229 nonsense probably null
R4462:Arhgef12 UTSW 9 42981982 missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42977662 missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42981970 missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42972153 missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 43020696 missense probably benign
R4840:Arhgef12 UTSW 9 42975068 missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42993065 nonsense probably null
R5176:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42986584 missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R5838:Arhgef12 UTSW 9 43005608 missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42988965 missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42972207 missense probably benign 0.05
R6959:Arhgef12 UTSW 9 43015953 missense probably benign
R7252:Arhgef12 UTSW 9 43015909 missense probably benign 0.17
R7470:Arhgef12 UTSW 9 43040552 missense probably damaging 1.00
R7658:Arhgef12 UTSW 9 42992536 missense probably damaging 1.00
R7724:Arhgef12 UTSW 9 43027271 missense probably damaging 1.00
R8074:Arhgef12 UTSW 9 42971103 nonsense probably null
RF020:Arhgef12 UTSW 9 42989989 missense possibly damaging 0.75
Z1176:Arhgef12 UTSW 9 42971072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGAGTCTCCTTGGAGTTTG -3'
(R):5'- CAATGGGAAATTCTGCTGGC -3'

Sequencing Primer
(F):5'- GTCTGCTTATACAGGTCTGAATAGAG -3'
(R):5'- CTGTGTTCAGTTGGCCTCACAAG -3'
Posted On2014-10-15