Incidental Mutation 'R2215:Myh2'
ID241102
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 040217-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R2215 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67191737 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1378 (W1378R)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect probably benign
Transcript: ENSMUST00000018641
AA Change: W1378R

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: W1378R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145346
Predicted Effect probably benign
Transcript: ENSMUST00000170159
AA Change: W1378R

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: W1378R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Meta Mutation Damage Score 0.9685 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef12 G T 9: 43,005,871 H391N probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Bmp8a C T 4: 123,325,118 V166I probably benign Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L3S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Dach1 A G 14: 98,168,481 probably null Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Ep400 A T 5: 110,693,555 probably benign Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Fbxo31 T C 8: 121,566,311 I112V probably benign Het
Galntl5 A T 5: 25,198,478 N149I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Igf1r T A 7: 68,165,234 D294E probably benign Het
Kdm6b G A 11: 69,405,044 P799L unknown Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr503 T C 7: 108,544,888 L119P probably damaging Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 probably benign Het
Pld1 A T 3: 28,078,393 I577F probably benign Het
Plekhm1 A T 11: 103,376,985 I720N probably damaging Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Sppl2a G T 2: 126,927,834 T34K probably benign Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
R7709:Myh2 UTSW 11 67194864 missense probably benign 0.00
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACCATCGTTAAGGGGACTG -3'
(R):5'- CTGGATTTTAAGTCAGCAGGAGG -3'

Sequencing Primer
(F):5'- CATCTCCATAGGCCAAGA -3'
(R):5'- TTTTAAGTCAGCAGGAGGTCAGG -3'
Posted On2014-10-15