Incidental Mutation 'R2215:Kdm6b'
ID241103
Institutional Source Beutler Lab
Gene Symbol Kdm6b
Ensembl Gene ENSMUSG00000018476
Gene NameKDM1 lysine (K)-specific demethylase 6B
SynonymsJmjd3
MMRRC Submission 040217-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2215 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69398508-69413675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69405044 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 799 (P799L)
Ref Sequence ENSEMBL: ENSMUSP00000091620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094077]
PDB Structure
The free structure of the mouse C-terminal domain of KDM6B [X-RAY DIFFRACTION]
free KDM6B structure [X-RAY DIFFRACTION]
the crystal structure of KDM6B bound with H3K27me3 peptide [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000094077
AA Change: P799L
SMART Domains Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476
AA Change: P799L

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 54 71 N/A INTRINSIC
SCOP:d1elwa_ 91 152 9e-5 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 239 270 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
low complexity region 389 415 N/A INTRINSIC
low complexity region 461 487 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
low complexity region 585 615 N/A INTRINSIC
low complexity region 643 650 N/A INTRINSIC
low complexity region 711 719 N/A INTRINSIC
low complexity region 743 766 N/A INTRINSIC
low complexity region 771 811 N/A INTRINSIC
low complexity region 840 879 N/A INTRINSIC
low complexity region 890 909 N/A INTRINSIC
low complexity region 950 989 N/A INTRINSIC
low complexity region 993 1011 N/A INTRINSIC
low complexity region 1044 1068 N/A INTRINSIC
low complexity region 1284 1317 N/A INTRINSIC
JmjC 1337 1500 1.61e-47 SMART
Blast:JmjC 1536 1600 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156562
Meta Mutation Damage Score 0.0839 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysine-specific demethylase that specifically demethylates di- or tri-methylated lysine 27 of histone H3 (H3K27me2 or H3K27me3). H3K27 trimethylation is a repressive epigenetic mark controlling chromatin organization and gene silencing. This protein can also demethylate non-histone proteins such as retinoblastoma protein. Through its demethylation actvity this gene influences cellular differentiation and development, tumorigenesis, inflammatory diseases, and neurodegenerative diseases. This protein has two classical nuclear localization signals at its N-terminus. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a null allele show perinatal death, thick alveolar septum, and absence of air space in the lungs. Mice homozygous for a different null allele die neonatally displaying abnormal lung development, dwarfism, kyphosis, short limbs, and a severe delay in endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef12 G T 9: 43,005,871 H391N probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Bmp8a C T 4: 123,325,118 V166I probably benign Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L3S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Dach1 A G 14: 98,168,481 probably null Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Ep400 A T 5: 110,693,555 probably benign Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Fbxo31 T C 8: 121,566,311 I112V probably benign Het
Galntl5 A T 5: 25,198,478 N149I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Igf1r T A 7: 68,165,234 D294E probably benign Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Myh2 T C 11: 67,191,737 W1378R probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr503 T C 7: 108,544,888 L119P probably damaging Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 probably benign Het
Pld1 A T 3: 28,078,393 I577F probably benign Het
Plekhm1 A T 11: 103,376,985 I720N probably damaging Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Sppl2a G T 2: 126,927,834 T34K probably benign Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Kdm6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Kdm6b APN 11 69406306 missense possibly damaging 0.85
IGL02271:Kdm6b APN 11 69406067 missense possibly damaging 0.65
beine UTSW 11 69403592 missense unknown
Knochen UTSW 11 69400055 unclassified probably benign
Ostentatious UTSW 11 69403598 missense unknown
Piquant UTSW 11 69403794 missense unknown
Tart UTSW 11 69406366 missense probably damaging 1.00
PIT4458001:Kdm6b UTSW 11 69399952 missense unknown
R0455:Kdm6b UTSW 11 69406996 nonsense probably null
R0645:Kdm6b UTSW 11 69405018 missense unknown
R1659:Kdm6b UTSW 11 69407588 missense possibly damaging 0.88
R1855:Kdm6b UTSW 11 69407286 missense probably damaging 0.99
R1962:Kdm6b UTSW 11 69401365 unclassified probably benign
R1993:Kdm6b UTSW 11 69406303 missense probably null 0.85
R2029:Kdm6b UTSW 11 69403592 missense unknown
R2181:Kdm6b UTSW 11 69401126 nonsense probably null
R2904:Kdm6b UTSW 11 69405785 missense possibly damaging 0.63
R2992:Kdm6b UTSW 11 69406307 small deletion probably benign
R3236:Kdm6b UTSW 11 69406366 missense probably damaging 1.00
R3950:Kdm6b UTSW 11 69405615 missense probably damaging 1.00
R4027:Kdm6b UTSW 11 69406268 missense possibly damaging 0.92
R4830:Kdm6b UTSW 11 69403794 missense unknown
R4996:Kdm6b UTSW 11 69405731 missense probably damaging 1.00
R5034:Kdm6b UTSW 11 69401910 splice site probably benign
R5140:Kdm6b UTSW 11 69400055 unclassified probably benign
R5160:Kdm6b UTSW 11 69400768 unclassified probably benign
R5240:Kdm6b UTSW 11 69401904 splice site probably benign
R5273:Kdm6b UTSW 11 69404201 missense unknown
R5386:Kdm6b UTSW 11 69400810 unclassified probably benign
R5597:Kdm6b UTSW 11 69406074 missense probably damaging 0.96
R5598:Kdm6b UTSW 11 69406074 missense probably damaging 0.96
R5812:Kdm6b UTSW 11 69405929 missense probably damaging 0.98
R5976:Kdm6b UTSW 11 69403788 critical splice donor site probably null
R6000:Kdm6b UTSW 11 69403598 missense unknown
R6145:Kdm6b UTSW 11 69405026 missense unknown
R6191:Kdm6b UTSW 11 69406758 missense probably benign 0.01
R6256:Kdm6b UTSW 11 69406729 missense probably damaging 0.96
R6304:Kdm6b UTSW 11 69404258 missense unknown
R6917:Kdm6b UTSW 11 69406593 missense probably benign 0.04
R6939:Kdm6b UTSW 11 69406762 missense probably damaging 0.99
R7356:Kdm6b UTSW 11 69402165 nonsense probably null
R7644:Kdm6b UTSW 11 69400206 missense unknown
R7673:Kdm6b UTSW 11 69405742 missense probably damaging 0.98
R7698:Kdm6b UTSW 11 69405981 missense probably benign 0.14
R7776:Kdm6b UTSW 11 69406134 missense possibly damaging 0.84
Z1177:Kdm6b UTSW 11 69403866 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGACTCAGAACGAGCAGG -3'
(R):5'- CCATTTCCCAGTGACACAGC -3'

Sequencing Primer
(F):5'- CCGCCTGAGGTAGAGAACTG -3'
(R):5'- GTGACACAGCCCCAGCC -3'
Posted On2014-10-15