Incidental Mutation 'R2215:Dach1'
ID241115
Institutional Source Beutler Lab
Gene Symbol Dach1
Ensembl Gene ENSMUSG00000055639
Gene Namedachshund family transcription factor 1
SynonymsDac, E130112M23Rik
MMRRC Submission 040217-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2215 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location97786853-98169765 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 98168481 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069334] [ENSMUST00000071533]
Predicted Effect probably null
Transcript: ENSMUST00000069334
SMART Domains Protein: ENSMUSP00000064970
Gene: ENSMUSG00000055639

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
low complexity region 61 97 N/A INTRINSIC
low complexity region 102 156 N/A INTRINSIC
Pfam:Ski_Sno 159 275 4.8e-53 PFAM
low complexity region 318 334 N/A INTRINSIC
low complexity region 443 470 N/A INTRINSIC
SCOP:d1eq1a_ 556 674 1e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000071533
SMART Domains Protein: ENSMUSP00000071464
Gene: ENSMUSG00000055639

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
low complexity region 61 97 N/A INTRINSIC
low complexity region 102 156 N/A INTRINSIC
Pfam:Ski_Sno 164 274 6.5e-42 PFAM
low complexity region 318 334 N/A INTRINSIC
low complexity region 495 522 N/A INTRINSIC
SCOP:d1eq1a_ 608 726 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156684
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Drosophila to human. Expression of this gene is lost in some forms of metastatic cancer, and is correlated with poor prognosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: In spite of normal gross morphology, mice homozygous for targeted mutations that inactivate this gene die within 1 day of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef12 G T 9: 43,005,871 H391N probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Bmp8a C T 4: 123,325,118 V166I probably benign Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L3S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Ep400 A T 5: 110,693,555 probably benign Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Fbxo31 T C 8: 121,566,311 I112V probably benign Het
Galntl5 A T 5: 25,198,478 N149I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Igf1r T A 7: 68,165,234 D294E probably benign Het
Kdm6b G A 11: 69,405,044 P799L unknown Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Myh2 T C 11: 67,191,737 W1378R probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr503 T C 7: 108,544,888 L119P probably damaging Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 probably benign Het
Pld1 A T 3: 28,078,393 I577F probably benign Het
Plekhm1 A T 11: 103,376,985 I720N probably damaging Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Sppl2a G T 2: 126,927,834 T34K probably benign Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Dach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Dach1 APN 14 97901422 missense possibly damaging 0.83
IGL01101:Dach1 APN 14 97840204 missense possibly damaging 0.83
IGL02033:Dach1 APN 14 97901429 missense possibly damaging 0.82
IGL02116:Dach1 APN 14 97901423 missense probably damaging 0.98
IGL02583:Dach1 APN 14 97828394 splice site probably benign
IGL02937:Dach1 APN 14 97915795 critical splice donor site probably null
IGL03120:Dach1 APN 14 97827789 missense probably damaging 1.00
R0016:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0017:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0117:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0334:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0336:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0371:Dach1 UTSW 14 97969903 missense probably damaging 0.99
R0511:Dach1 UTSW 14 97901329 missense possibly damaging 0.94
R0538:Dach1 UTSW 14 97903279 missense possibly damaging 0.80
R0799:Dach1 UTSW 14 98168615 missense possibly damaging 0.79
R0928:Dach1 UTSW 14 97915832 missense probably damaging 0.98
R0939:Dach1 UTSW 14 97915924 missense probably damaging 0.99
R1512:Dach1 UTSW 14 97901399 missense probably damaging 0.99
R1646:Dach1 UTSW 14 98169114 missense unknown
R1865:Dach1 UTSW 14 97840209 missense possibly damaging 0.68
R1881:Dach1 UTSW 14 97901396 missense probably benign 0.20
R1909:Dach1 UTSW 14 97901393 missense probably damaging 1.00
R1980:Dach1 UTSW 14 97831341 missense probably damaging 1.00
R2570:Dach1 UTSW 14 97901411 missense probably benign 0.17
R3924:Dach1 UTSW 14 97915903 missense probably damaging 1.00
R3957:Dach1 UTSW 14 97840109 missense probably damaging 0.99
R4095:Dach1 UTSW 14 97901379 missense possibly damaging 0.92
R4373:Dach1 UTSW 14 97827750 missense possibly damaging 0.94
R5350:Dach1 UTSW 14 97969959 missense probably damaging 1.00
R5428:Dach1 UTSW 14 98169269 missense unknown
R5818:Dach1 UTSW 14 98168684 missense probably damaging 1.00
R6824:Dach1 UTSW 14 98018892 missense possibly damaging 0.81
R6967:Dach1 UTSW 14 97903197 missense probably damaging 1.00
R7263:Dach1 UTSW 14 98168859 missense probably benign
R7701:Dach1 UTSW 14 97903234 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGAATGCCCTAGGAAGCATCAG -3'
(R):5'- CGTCTACACCAAGCTGAAGC -3'

Sequencing Primer
(F):5'- AGCAGTGCGAACTTGCC -3'
(R):5'- CTGAAGCGGTTGGAGATCAC -3'
Posted On2014-10-15