Incidental Mutation 'R0165:Tlr9'
ID 24112
Institutional Source Beutler Lab
Gene Symbol Tlr9
Ensembl Gene ENSMUSG00000045322
Gene Name toll-like receptor 9
Synonyms
MMRRC Submission 038441-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R0165 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 9
Chromosomal Location 106222598-106226883 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 106226087 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 859 (A859D)
Ref Sequence ENSEMBL: ENSMUSP00000082207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062241]
AlphaFold Q9EQU3
PDB Structure Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000062241
AA Change: A859D

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: A859D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Tlr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 1.00
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.90
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 1.00
IGL02851:Tlr9 APN 9 106224730 nonsense probably null
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 1.00
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
cpg7 UTSW 9 106225349 missense probably benign 0.00
Meager UTSW 9 106224139 missense probably damaging 1.00
PIT4498001:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.01
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign
R1940:Tlr9 UTSW 9 106224647 missense probably damaging 1.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.47
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 critical splice donor site probably null
R6393:Tlr9 UTSW 9 106224937 missense probably damaging 1.00
R6397:Tlr9 UTSW 9 106225106 missense probably damaging 1.00
R6455:Tlr9 UTSW 9 106223999 missense probably damaging 1.00
R7385:Tlr9 UTSW 9 106225264 missense probably damaging 1.00
R7455:Tlr9 UTSW 9 106224530 missense probably benign 0.00
R7561:Tlr9 UTSW 9 106225949 missense probably benign 0.00
R8889:Tlr9 UTSW 9 106222635 start gained probably benign
R8892:Tlr9 UTSW 9 106222635 start gained probably benign
R8926:Tlr9 UTSW 9 106226014 missense probably benign
R9221:Tlr9 UTSW 9 106224773 missense probably damaging 1.00
R9228:Tlr9 UTSW 9 106225553 missense possibly damaging 0.49
R9581:Tlr9 UTSW 9 106224311 missense probably damaging 1.00
R9689:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R9697:Tlr9 UTSW 9 106223524 nonsense probably null
R9788:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
Z1176:Tlr9 UTSW 9 106223663 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAATGGTGTGAAGTGTGGCAGCCC -3'
(R):5'- ATGGAAGCCCAGAGGTTCTCGAAG -3'

Sequencing Primer
(F):5'- CAGGGCCGTAGCATCTTC -3'
(R):5'- CAGAGGTTCTCGAAGAGCGTC -3'
Posted On 2013-04-16