Incidental Mutation 'R2216:Vil1'
ID 241131
Institutional Source Beutler Lab
Gene Symbol Vil1
Ensembl Gene ENSMUSG00000026175
Gene Name villin 1
Synonyms Villin
MMRRC Submission 040218-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R2216 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 74448543-74474719 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 74464838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 495 (R495L)
Ref Sequence ENSEMBL: ENSMUSP00000027366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027366]
AlphaFold Q62468
Predicted Effect probably benign
Transcript: ENSMUST00000027366
AA Change: R495L

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: R495L

DomainStartEndE-ValueType
GEL 17 114 2.93e-29 SMART
GEL 135 229 1.33e-18 SMART
GEL 251 349 5.85e-29 SMART
GEL 398 495 1.44e-28 SMART
GEL 515 601 7.31e-30 SMART
GEL 620 714 1.36e-29 SMART
VHP 792 827 1.77e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159749
SMART Domains Protein: ENSMUSP00000123786
Gene: ENSMUSG00000026175

DomainStartEndE-ValueType
GEL 37 131 1.33e-18 SMART
GEL 153 248 6.68e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163018
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)          

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 71,922,272 (GRCm39) P146T probably damaging Het
Arnt2 T A 7: 83,924,559 (GRCm39) T423S probably damaging Het
Bend5 A G 4: 111,305,787 (GRCm39) N277S probably null Het
Cd22 G T 7: 30,566,471 (GRCm39) T816N probably damaging Het
Cep126 G A 9: 8,120,679 (GRCm39) R115C probably damaging Het
Cep85 T C 4: 133,858,741 (GRCm39) H710R possibly damaging Het
Cmya5 A T 13: 93,230,003 (GRCm39) L1695H probably damaging Het
Col24a1 T C 3: 145,020,742 (GRCm39) V371A probably benign Het
Csmd1 T A 8: 17,077,355 (GRCm39) probably null Het
Cyp1a1 T A 9: 57,609,352 (GRCm39) probably null Het
Dennd1c C T 17: 57,381,492 (GRCm39) probably null Het
Dmxl1 G A 18: 50,026,990 (GRCm39) V2033I probably benign Het
Dtna A G 18: 23,702,622 (GRCm39) H51R probably damaging Het
Dysf G A 6: 84,184,227 (GRCm39) probably null Het
Gcn1 T A 5: 115,731,720 (GRCm39) V945E probably benign Het
Gpbar1 C G 1: 74,318,053 (GRCm39) L99V probably damaging Het
Hdac9 A T 12: 34,479,516 (GRCm39) D212E probably damaging Het
Itga1 A T 13: 115,133,565 (GRCm39) D448E probably benign Het
Itga2b T A 11: 102,358,692 (GRCm39) N75I probably benign Het
Klra7 T C 6: 130,205,549 (GRCm39) E117G probably benign Het
Kmt2b G A 7: 30,273,490 (GRCm39) R2349C probably benign Het
Masp1 T C 16: 23,310,805 (GRCm39) N209S probably benign Het
Mybpc2 C T 7: 44,161,924 (GRCm39) probably null Het
Myh15 C G 16: 48,986,201 (GRCm39) S1557* probably null Het
Myo3a A C 2: 22,467,783 (GRCm39) T346P probably benign Het
Nim1k A G 13: 120,175,751 (GRCm39) Y152H probably damaging Het
Nrp2 C T 1: 62,802,077 (GRCm39) R507* probably null Het
Or13n4 T A 7: 106,423,205 (GRCm39) H176L probably damaging Het
Or5e1 C T 7: 108,354,819 (GRCm39) T252M probably damaging Het
Parp14 T C 16: 35,677,575 (GRCm39) I798V probably benign Het
Pcnx2 C T 8: 126,614,816 (GRCm39) A212T probably benign Het
Pkhd1l1 A T 15: 44,437,291 (GRCm39) H3522L probably damaging Het
Pram1 C T 17: 33,860,258 (GRCm39) A275V probably benign Het
Pramel18 T A 4: 101,767,257 (GRCm39) W169R probably damaging Het
Prkag1 A T 15: 98,713,827 (GRCm39) M1K probably null Het
Prss52 T C 14: 64,351,042 (GRCm39) S276P probably damaging Het
Ranbp17 A T 11: 33,431,125 (GRCm39) V284D probably damaging Het
Reln T C 5: 22,253,003 (GRCm39) D648G probably benign Het
Rnf112 A G 11: 61,343,105 (GRCm39) L190P probably damaging Het
Scn5a G T 9: 119,314,678 (GRCm39) P2010Q probably benign Het
Scn5a T C 9: 119,342,151 (GRCm39) Y1138C probably benign Het
Slc4a9 A G 18: 36,663,798 (GRCm39) H274R probably benign Het
Slc5a6 T G 5: 31,196,679 (GRCm39) E391D possibly damaging Het
Speer2 T C 16: 69,655,730 (GRCm39) Q32R possibly damaging Het
Tars1 A G 15: 11,389,794 (GRCm39) V372A probably benign Het
Thsd7a A T 6: 12,337,267 (GRCm39) L1250Q possibly damaging Het
Tnnt3 A G 7: 142,066,301 (GRCm39) Y222C probably benign Het
Trim40 T C 17: 37,199,875 (GRCm39) I68V probably benign Het
Trp53tg5 T C 2: 164,313,226 (GRCm39) I150V probably benign Het
Ube2u T C 4: 100,389,365 (GRCm39) V109A probably benign Het
Usp54 A T 14: 20,611,908 (GRCm39) D969E probably benign Het
Wfs1 T A 5: 37,124,564 (GRCm39) K700* probably null Het
Zcchc8 A G 5: 123,845,466 (GRCm39) L298P probably damaging Het
Zfp946 A T 17: 22,673,697 (GRCm39) Q150H possibly damaging Het
Other mutations in Vil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Vil1 APN 1 74,463,034 (GRCm39) missense probably damaging 1.00
IGL00703:Vil1 APN 1 74,463,119 (GRCm39) missense possibly damaging 0.61
IGL01011:Vil1 APN 1 74,474,046 (GRCm39) splice site probably null
IGL01314:Vil1 APN 1 74,467,397 (GRCm39) missense probably damaging 1.00
IGL01772:Vil1 APN 1 74,454,278 (GRCm39) missense probably benign
IGL02378:Vil1 APN 1 74,469,850 (GRCm39) splice site probably null
IGL02517:Vil1 APN 1 74,465,851 (GRCm39) missense probably benign 0.43
IGL02955:Vil1 APN 1 74,457,682 (GRCm39) missense probably benign 0.10
IGL03036:Vil1 APN 1 74,458,771 (GRCm39) missense probably damaging 1.00
PIT4362001:Vil1 UTSW 1 74,460,542 (GRCm39) missense probably damaging 1.00
R0104:Vil1 UTSW 1 74,457,525 (GRCm39) missense probably benign 0.44
R0241:Vil1 UTSW 1 74,465,853 (GRCm39) missense probably damaging 1.00
R0241:Vil1 UTSW 1 74,465,853 (GRCm39) missense probably damaging 1.00
R0496:Vil1 UTSW 1 74,460,499 (GRCm39) missense possibly damaging 0.88
R1329:Vil1 UTSW 1 74,466,717 (GRCm39) missense probably benign 0.00
R1824:Vil1 UTSW 1 74,457,606 (GRCm39) missense probably benign 0.00
R1916:Vil1 UTSW 1 74,457,684 (GRCm39) missense probably benign
R2188:Vil1 UTSW 1 74,466,724 (GRCm39) missense probably benign 0.22
R3808:Vil1 UTSW 1 74,466,772 (GRCm39) missense probably benign
R3939:Vil1 UTSW 1 74,471,574 (GRCm39) missense probably benign 0.09
R4288:Vil1 UTSW 1 74,457,684 (GRCm39) missense probably benign
R4648:Vil1 UTSW 1 74,471,457 (GRCm39) missense probably benign
R4748:Vil1 UTSW 1 74,460,425 (GRCm39) missense probably damaging 1.00
R5333:Vil1 UTSW 1 74,471,549 (GRCm39) missense probably benign
R5429:Vil1 UTSW 1 74,471,490 (GRCm39) missense probably benign 0.05
R5973:Vil1 UTSW 1 74,455,192 (GRCm39) missense possibly damaging 0.93
R6007:Vil1 UTSW 1 74,459,026 (GRCm39) missense probably damaging 1.00
R6247:Vil1 UTSW 1 74,471,498 (GRCm39) missense probably benign
R6306:Vil1 UTSW 1 74,460,470 (GRCm39) missense possibly damaging 0.90
R6989:Vil1 UTSW 1 74,463,113 (GRCm39) missense probably damaging 0.99
R7112:Vil1 UTSW 1 74,455,161 (GRCm39) missense probably damaging 1.00
R7320:Vil1 UTSW 1 74,457,603 (GRCm39) missense probably damaging 1.00
R7481:Vil1 UTSW 1 74,459,058 (GRCm39) missense probably damaging 1.00
R7553:Vil1 UTSW 1 74,465,891 (GRCm39) critical splice donor site probably null
R7709:Vil1 UTSW 1 74,465,754 (GRCm39) missense probably benign 0.39
R7791:Vil1 UTSW 1 74,467,295 (GRCm39) missense probably damaging 1.00
R8159:Vil1 UTSW 1 74,463,136 (GRCm39) missense probably benign 0.00
R8190:Vil1 UTSW 1 74,474,052 (GRCm39) nonsense probably null
R9650:Vil1 UTSW 1 74,464,775 (GRCm39) missense probably benign 0.32
R9679:Vil1 UTSW 1 74,469,833 (GRCm39) missense probably benign 0.00
R9734:Vil1 UTSW 1 74,454,309 (GRCm39) missense possibly damaging 0.46
Z1176:Vil1 UTSW 1 74,467,391 (GRCm39) missense probably damaging 0.98
Z1177:Vil1 UTSW 1 74,460,589 (GRCm39) missense probably benign
Z1177:Vil1 UTSW 1 74,454,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCAAACTCAGGACCCCAT -3'
(R):5'- TTCATGGAGCAGAGACCAAG -3'

Sequencing Primer
(F):5'- GGACCCCATCCTCCCCTTC -3'
(R):5'- ATATTTGTACACTTCGAAGGTTCC -3'
Posted On 2014-10-15