Incidental Mutation 'R2216:Trp53tg5'
ID 241136
Institutional Source Beutler Lab
Gene Symbol Trp53tg5
Ensembl Gene ENSMUSG00000017720
Gene Name transformation related protein 53 target 5
Synonyms 1700126L10Rik
MMRRC Submission 040218-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R2216 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 164312221-164315644 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 164313226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 150 (I150V)
Ref Sequence ENSEMBL: ENSMUSP00000017864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017864] [ENSMUST00000125086] [ENSMUST00000138268] [ENSMUST00000142892] [ENSMUST00000164863]
AlphaFold Q9D976
Predicted Effect probably benign
Transcript: ENSMUST00000017864
AA Change: I150V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000017864
Gene: ENSMUSG00000017720
AA Change: I150V

DomainStartEndE-ValueType
Pfam:TP53IP5 28 238 2e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125086
SMART Domains Protein: ENSMUSP00000121900
Gene: ENSMUSG00000045503

DomainStartEndE-ValueType
Pfam:SYS1 5 148 9.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138268
SMART Domains Protein: ENSMUSP00000117507
Gene: ENSMUSG00000045503

DomainStartEndE-ValueType
Pfam:SYS1 5 76 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142892
SMART Domains Protein: ENSMUSP00000114360
Gene: ENSMUSG00000045503

DomainStartEndE-ValueType
Pfam:SYS1 5 76 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164863
SMART Domains Protein: ENSMUSP00000126658
Gene: ENSMUSG00000090996

DomainStartEndE-ValueType
Pfam:SYS1 5 78 6.7e-22 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 71,922,272 (GRCm39) P146T probably damaging Het
Arnt2 T A 7: 83,924,559 (GRCm39) T423S probably damaging Het
Bend5 A G 4: 111,305,787 (GRCm39) N277S probably null Het
Cd22 G T 7: 30,566,471 (GRCm39) T816N probably damaging Het
Cep126 G A 9: 8,120,679 (GRCm39) R115C probably damaging Het
Cep85 T C 4: 133,858,741 (GRCm39) H710R possibly damaging Het
Cmya5 A T 13: 93,230,003 (GRCm39) L1695H probably damaging Het
Col24a1 T C 3: 145,020,742 (GRCm39) V371A probably benign Het
Csmd1 T A 8: 17,077,355 (GRCm39) probably null Het
Cyp1a1 T A 9: 57,609,352 (GRCm39) probably null Het
Dennd1c C T 17: 57,381,492 (GRCm39) probably null Het
Dmxl1 G A 18: 50,026,990 (GRCm39) V2033I probably benign Het
Dtna A G 18: 23,702,622 (GRCm39) H51R probably damaging Het
Dysf G A 6: 84,184,227 (GRCm39) probably null Het
Gcn1 T A 5: 115,731,720 (GRCm39) V945E probably benign Het
Gpbar1 C G 1: 74,318,053 (GRCm39) L99V probably damaging Het
Hdac9 A T 12: 34,479,516 (GRCm39) D212E probably damaging Het
Itga1 A T 13: 115,133,565 (GRCm39) D448E probably benign Het
Itga2b T A 11: 102,358,692 (GRCm39) N75I probably benign Het
Klra7 T C 6: 130,205,549 (GRCm39) E117G probably benign Het
Kmt2b G A 7: 30,273,490 (GRCm39) R2349C probably benign Het
Masp1 T C 16: 23,310,805 (GRCm39) N209S probably benign Het
Mybpc2 C T 7: 44,161,924 (GRCm39) probably null Het
Myh15 C G 16: 48,986,201 (GRCm39) S1557* probably null Het
Myo3a A C 2: 22,467,783 (GRCm39) T346P probably benign Het
Nim1k A G 13: 120,175,751 (GRCm39) Y152H probably damaging Het
Nrp2 C T 1: 62,802,077 (GRCm39) R507* probably null Het
Or13n4 T A 7: 106,423,205 (GRCm39) H176L probably damaging Het
Or5e1 C T 7: 108,354,819 (GRCm39) T252M probably damaging Het
Parp14 T C 16: 35,677,575 (GRCm39) I798V probably benign Het
Pcnx2 C T 8: 126,614,816 (GRCm39) A212T probably benign Het
Pkhd1l1 A T 15: 44,437,291 (GRCm39) H3522L probably damaging Het
Pram1 C T 17: 33,860,258 (GRCm39) A275V probably benign Het
Pramel18 T A 4: 101,767,257 (GRCm39) W169R probably damaging Het
Prkag1 A T 15: 98,713,827 (GRCm39) M1K probably null Het
Prss52 T C 14: 64,351,042 (GRCm39) S276P probably damaging Het
Ranbp17 A T 11: 33,431,125 (GRCm39) V284D probably damaging Het
Reln T C 5: 22,253,003 (GRCm39) D648G probably benign Het
Rnf112 A G 11: 61,343,105 (GRCm39) L190P probably damaging Het
Scn5a G T 9: 119,314,678 (GRCm39) P2010Q probably benign Het
Scn5a T C 9: 119,342,151 (GRCm39) Y1138C probably benign Het
Slc4a9 A G 18: 36,663,798 (GRCm39) H274R probably benign Het
Slc5a6 T G 5: 31,196,679 (GRCm39) E391D possibly damaging Het
Speer2 T C 16: 69,655,730 (GRCm39) Q32R possibly damaging Het
Tars1 A G 15: 11,389,794 (GRCm39) V372A probably benign Het
Thsd7a A T 6: 12,337,267 (GRCm39) L1250Q possibly damaging Het
Tnnt3 A G 7: 142,066,301 (GRCm39) Y222C probably benign Het
Trim40 T C 17: 37,199,875 (GRCm39) I68V probably benign Het
Ube2u T C 4: 100,389,365 (GRCm39) V109A probably benign Het
Usp54 A T 14: 20,611,908 (GRCm39) D969E probably benign Het
Vil1 G T 1: 74,464,838 (GRCm39) R495L probably benign Het
Wfs1 T A 5: 37,124,564 (GRCm39) K700* probably null Het
Zcchc8 A G 5: 123,845,466 (GRCm39) L298P probably damaging Het
Zfp946 A T 17: 22,673,697 (GRCm39) Q150H possibly damaging Het
Other mutations in Trp53tg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Trp53tg5 APN 2 164,313,376 (GRCm39) missense possibly damaging 0.75
R0538:Trp53tg5 UTSW 2 164,313,401 (GRCm39) missense probably damaging 0.98
R1348:Trp53tg5 UTSW 2 164,315,521 (GRCm39) critical splice donor site probably null
R2423:Trp53tg5 UTSW 2 164,313,250 (GRCm39) nonsense probably null
R3034:Trp53tg5 UTSW 2 164,313,219 (GRCm39) missense probably benign 0.00
R5569:Trp53tg5 UTSW 2 164,313,256 (GRCm39) missense probably benign 0.00
R5842:Trp53tg5 UTSW 2 164,313,289 (GRCm39) missense possibly damaging 0.56
R6021:Trp53tg5 UTSW 2 164,313,391 (GRCm39) missense probably benign 0.00
R7206:Trp53tg5 UTSW 2 164,313,378 (GRCm39) missense probably damaging 1.00
R7366:Trp53tg5 UTSW 2 164,313,027 (GRCm39) missense possibly damaging 0.78
R9705:Trp53tg5 UTSW 2 164,313,208 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATCTACACATGATCCGGCG -3'
(R):5'- AGCCTTAATCTGCTGATGGTC -3'

Sequencing Primer
(F):5'- CGCCCTGGGATGTGTATGC -3'
(R):5'- CCTGCCAGGGACAAGGAC -3'
Posted On 2014-10-15