Incidental Mutation 'R2216:Gm12800'
ID241139
Institutional Source Beutler Lab
Gene Symbol Gm12800
Ensembl Gene ENSMUSG00000037028
Gene Namepredicted gene 12800
Synonyms
MMRRC Submission 040218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2216 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location101909121-101911908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101910060 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 169 (W169R)
Ref Sequence ENSEMBL: ENSMUSP00000075380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075999]
Predicted Effect probably damaging
Transcript: ENSMUST00000075999
AA Change: W169R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075380
Gene: ENSMUSG00000037028
AA Change: W169R

DomainStartEndE-ValueType
SCOP:d1a4ya_ 206 410 9e-11 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 72,031,446 P146T probably damaging Het
Arnt2 T A 7: 84,275,351 T423S probably damaging Het
Bend5 A G 4: 111,448,590 N277S probably null Het
Cd22 G T 7: 30,867,046 T816N probably damaging Het
Cep126 G A 9: 8,120,678 R115C probably damaging Het
Cep85 T C 4: 134,131,430 H710R possibly damaging Het
Cmya5 A T 13: 93,093,495 L1695H probably damaging Het
Col24a1 T C 3: 145,314,981 V371A probably benign Het
Csmd1 T A 8: 17,027,339 probably null Het
Cyp1a1 T A 9: 57,702,069 probably null Het
Dennd1c C T 17: 57,074,492 probably null Het
Dmxl1 G A 18: 49,893,923 V2033I probably benign Het
Dtna A G 18: 23,569,565 H51R probably damaging Het
Dysf G A 6: 84,207,245 probably null Het
Gcn1l1 T A 5: 115,593,661 V945E probably benign Het
Gpbar1 C G 1: 74,278,894 L99V probably damaging Het
Hdac9 A T 12: 34,429,517 D212E probably damaging Het
Itga1 A T 13: 114,997,029 D448E probably benign Het
Itga2b T A 11: 102,467,866 N75I probably benign Het
Klra7 T C 6: 130,228,586 E117G probably benign Het
Kmt2b G A 7: 30,574,065 R2349C probably benign Het
Masp1 T C 16: 23,492,055 N209S probably benign Het
Mybpc2 C T 7: 44,512,500 probably null Het
Myh15 C G 16: 49,165,838 S1557* probably null Het
Myo3a A C 2: 22,577,771 T346P probably benign Het
Nim1k A G 13: 119,714,215 Y152H probably damaging Het
Nrp2 C T 1: 62,762,918 R507* probably null Het
Olfr513 C T 7: 108,755,612 T252M probably damaging Het
Olfr702 T A 7: 106,823,998 H176L probably damaging Het
Parp14 T C 16: 35,857,205 I798V probably benign Het
Pcnx2 C T 8: 125,888,077 A212T probably benign Het
Pkhd1l1 A T 15: 44,573,895 H3522L probably damaging Het
Pram1 C T 17: 33,641,284 A275V probably benign Het
Prkag1 A T 15: 98,815,946 M1K probably null Het
Prss52 T C 14: 64,113,593 S276P probably damaging Het
Ranbp17 A T 11: 33,481,125 V284D probably damaging Het
Reln T C 5: 22,048,005 D648G probably benign Het
Rnf112 A G 11: 61,452,279 L190P probably damaging Het
Scn5a G T 9: 119,485,612 P2010Q probably benign Het
Scn5a T C 9: 119,513,085 Y1138C probably benign Het
Slc4a9 A G 18: 36,530,745 H274R probably benign Het
Slc5a6 T G 5: 31,039,335 E391D possibly damaging Het
Speer2 T C 16: 69,858,842 Q32R possibly damaging Het
Tars A G 15: 11,389,708 V372A probably benign Het
Thsd7a A T 6: 12,337,268 L1250Q possibly damaging Het
Tnnt3 A G 7: 142,512,564 Y222C probably benign Het
Trim40 T C 17: 36,888,983 I68V probably benign Het
Trp53tg5 T C 2: 164,471,306 I150V probably benign Het
Ube2u T C 4: 100,532,168 V109A probably benign Het
Usp54 A T 14: 20,561,840 D969E probably benign Het
Vil1 G T 1: 74,425,679 R495L probably benign Het
Wfs1 T A 5: 36,967,220 K700* probably null Het
Zcchc8 A G 5: 123,707,403 L298P probably damaging Het
Zfp946 A T 17: 22,454,716 Q150H possibly damaging Het
Other mutations in Gm12800
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02430:Gm12800 APN 4 101910280 missense probably benign 0.02
IGL02683:Gm12800 APN 4 101910354 missense probably benign 0.00
IGL03403:Gm12800 APN 4 101909928 missense probably benign 0.40
R0833:Gm12800 UTSW 4 101910097 missense probably damaging 0.97
R1054:Gm12800 UTSW 4 101909164 missense probably benign 0.00
R1953:Gm12800 UTSW 4 101910115 missense probably benign
R3746:Gm12800 UTSW 4 101909876 missense possibly damaging 0.63
R3747:Gm12800 UTSW 4 101909876 missense possibly damaging 0.63
R3750:Gm12800 UTSW 4 101909876 missense possibly damaging 0.63
R4931:Gm12800 UTSW 4 101909170 missense possibly damaging 0.47
R5102:Gm12800 UTSW 4 101909239 missense probably damaging 1.00
R5586:Gm12800 UTSW 4 101910120 missense probably benign 0.00
R5822:Gm12800 UTSW 4 101910243 missense probably damaging 1.00
R6395:Gm12800 UTSW 4 101909992 missense probably benign
R6904:Gm12800 UTSW 4 101910094 missense possibly damaging 0.86
R7544:Gm12800 UTSW 4 101911402 missense possibly damaging 0.56
R7768:Gm12800 UTSW 4 101911813 missense probably benign
R8342:Gm12800 UTSW 4 101910384 missense probably benign 0.01
Z1088:Gm12800 UTSW 4 101910186 missense probably benign 0.00
Z1088:Gm12800 UTSW 4 101909118 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCTCACAGAAGAAGGAAGCTTC -3'
(R):5'- TCATCTGGCCAAAGCAAGG -3'

Sequencing Primer
(F):5'- GAGAGATTTGCACCACGATTTCTG -3'
(R):5'- GCAAGGAGCAAAGCAACTTAG -3'
Posted On2014-10-15