Incidental Mutation 'R2216:Bend5'
ID 241140
Institutional Source Beutler Lab
Gene Symbol Bend5
Ensembl Gene ENSMUSG00000028545
Gene Name BEN domain containing 5
Synonyms 2310026E23Rik
MMRRC Submission 040218-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # R2216 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 111272203-111317495 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111305787 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 277 (N277S)
Ref Sequence ENSEMBL: ENSMUSP00000030274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030274] [ENSMUST00000080744] [ENSMUST00000097920] [ENSMUST00000106591] [ENSMUST00000106592]
AlphaFold Q8C6D4
Predicted Effect probably null
Transcript: ENSMUST00000030274
AA Change: N277S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030274
Gene: ENSMUSG00000028545
AA Change: N277S

DomainStartEndE-ValueType
coiled coil region 180 242 N/A INTRINSIC
BEN 322 397 4.7e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080744
SMART Domains Protein: ENSMUSP00000079568
Gene: ENSMUSG00000061298

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097920
SMART Domains Protein: ENSMUSP00000095533
Gene: ENSMUSG00000061298

DomainStartEndE-ValueType
Zn_pept 169 465 3.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106591
SMART Domains Protein: ENSMUSP00000102201
Gene: ENSMUSG00000061298

DomainStartEndE-ValueType
Pfam:Peptidase_M14 174 321 3.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106592
SMART Domains Protein: ENSMUSP00000102202
Gene: ENSMUSG00000061298

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129760
Predicted Effect probably benign
Transcript: ENSMUST00000139876
SMART Domains Protein: ENSMUSP00000119368
Gene: ENSMUSG00000028545

DomainStartEndE-ValueType
coiled coil region 50 112 N/A INTRINSIC
Blast:BEN 115 150 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148038
SMART Domains Protein: ENSMUSP00000118551
Gene: ENSMUSG00000061298

DomainStartEndE-ValueType
Zn_pept 15 267 9.65e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 71,922,272 (GRCm39) P146T probably damaging Het
Arnt2 T A 7: 83,924,559 (GRCm39) T423S probably damaging Het
Cd22 G T 7: 30,566,471 (GRCm39) T816N probably damaging Het
Cep126 G A 9: 8,120,679 (GRCm39) R115C probably damaging Het
Cep85 T C 4: 133,858,741 (GRCm39) H710R possibly damaging Het
Cmya5 A T 13: 93,230,003 (GRCm39) L1695H probably damaging Het
Col24a1 T C 3: 145,020,742 (GRCm39) V371A probably benign Het
Csmd1 T A 8: 17,077,355 (GRCm39) probably null Het
Cyp1a1 T A 9: 57,609,352 (GRCm39) probably null Het
Dennd1c C T 17: 57,381,492 (GRCm39) probably null Het
Dmxl1 G A 18: 50,026,990 (GRCm39) V2033I probably benign Het
Dtna A G 18: 23,702,622 (GRCm39) H51R probably damaging Het
Dysf G A 6: 84,184,227 (GRCm39) probably null Het
Gcn1 T A 5: 115,731,720 (GRCm39) V945E probably benign Het
Gpbar1 C G 1: 74,318,053 (GRCm39) L99V probably damaging Het
Hdac9 A T 12: 34,479,516 (GRCm39) D212E probably damaging Het
Itga1 A T 13: 115,133,565 (GRCm39) D448E probably benign Het
Itga2b T A 11: 102,358,692 (GRCm39) N75I probably benign Het
Klra7 T C 6: 130,205,549 (GRCm39) E117G probably benign Het
Kmt2b G A 7: 30,273,490 (GRCm39) R2349C probably benign Het
Masp1 T C 16: 23,310,805 (GRCm39) N209S probably benign Het
Mybpc2 C T 7: 44,161,924 (GRCm39) probably null Het
Myh15 C G 16: 48,986,201 (GRCm39) S1557* probably null Het
Myo3a A C 2: 22,467,783 (GRCm39) T346P probably benign Het
Nim1k A G 13: 120,175,751 (GRCm39) Y152H probably damaging Het
Nrp2 C T 1: 62,802,077 (GRCm39) R507* probably null Het
Or13n4 T A 7: 106,423,205 (GRCm39) H176L probably damaging Het
Or5e1 C T 7: 108,354,819 (GRCm39) T252M probably damaging Het
Parp14 T C 16: 35,677,575 (GRCm39) I798V probably benign Het
Pcnx2 C T 8: 126,614,816 (GRCm39) A212T probably benign Het
Pkhd1l1 A T 15: 44,437,291 (GRCm39) H3522L probably damaging Het
Pram1 C T 17: 33,860,258 (GRCm39) A275V probably benign Het
Pramel18 T A 4: 101,767,257 (GRCm39) W169R probably damaging Het
Prkag1 A T 15: 98,713,827 (GRCm39) M1K probably null Het
Prss52 T C 14: 64,351,042 (GRCm39) S276P probably damaging Het
Ranbp17 A T 11: 33,431,125 (GRCm39) V284D probably damaging Het
Reln T C 5: 22,253,003 (GRCm39) D648G probably benign Het
Rnf112 A G 11: 61,343,105 (GRCm39) L190P probably damaging Het
Scn5a G T 9: 119,314,678 (GRCm39) P2010Q probably benign Het
Scn5a T C 9: 119,342,151 (GRCm39) Y1138C probably benign Het
Slc4a9 A G 18: 36,663,798 (GRCm39) H274R probably benign Het
Slc5a6 T G 5: 31,196,679 (GRCm39) E391D possibly damaging Het
Speer2 T C 16: 69,655,730 (GRCm39) Q32R possibly damaging Het
Tars1 A G 15: 11,389,794 (GRCm39) V372A probably benign Het
Thsd7a A T 6: 12,337,267 (GRCm39) L1250Q possibly damaging Het
Tnnt3 A G 7: 142,066,301 (GRCm39) Y222C probably benign Het
Trim40 T C 17: 37,199,875 (GRCm39) I68V probably benign Het
Trp53tg5 T C 2: 164,313,226 (GRCm39) I150V probably benign Het
Ube2u T C 4: 100,389,365 (GRCm39) V109A probably benign Het
Usp54 A T 14: 20,611,908 (GRCm39) D969E probably benign Het
Vil1 G T 1: 74,464,838 (GRCm39) R495L probably benign Het
Wfs1 T A 5: 37,124,564 (GRCm39) K700* probably null Het
Zcchc8 A G 5: 123,845,466 (GRCm39) L298P probably damaging Het
Zfp946 A T 17: 22,673,697 (GRCm39) Q150H possibly damaging Het
Other mutations in Bend5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Bend5 APN 4 111,305,838 (GRCm39) missense probably damaging 0.99
IGL02083:Bend5 APN 4 111,316,964 (GRCm39) missense probably benign 0.44
IGL03202:Bend5 APN 4 111,290,441 (GRCm39) missense possibly damaging 0.79
IGL03379:Bend5 APN 4 111,311,468 (GRCm39) missense probably benign 0.06
PIT4378001:Bend5 UTSW 4 111,288,304 (GRCm39) missense probably benign
R0639:Bend5 UTSW 4 111,290,495 (GRCm39) missense probably benign 0.21
R1306:Bend5 UTSW 4 111,316,970 (GRCm39) nonsense probably null
R1535:Bend5 UTSW 4 111,316,960 (GRCm39) missense probably benign 0.06
R1768:Bend5 UTSW 4 111,311,438 (GRCm39) nonsense probably null
R2116:Bend5 UTSW 4 111,272,436 (GRCm39) missense probably benign 0.09
R2256:Bend5 UTSW 4 111,288,207 (GRCm39) intron probably benign
R3927:Bend5 UTSW 4 111,305,802 (GRCm39) missense possibly damaging 0.91
R5408:Bend5 UTSW 4 111,311,280 (GRCm39) critical splice acceptor site probably null
R5841:Bend5 UTSW 4 111,290,667 (GRCm39) missense probably damaging 1.00
R7860:Bend5 UTSW 4 111,272,406 (GRCm39) missense probably damaging 0.98
R8063:Bend5 UTSW 4 111,317,031 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACTATATGCTGATAGATGC -3'
(R):5'- GAAGTCCCAGGAAACCTATGC -3'

Sequencing Primer
(F):5'- CCGCCATTGACTTGGAAA -3'
(R):5'- GTCCCAGGAAACCTATGCTACTATG -3'
Posted On 2014-10-15