Incidental Mutation 'R2216:Cep85'
ID241142
Institutional Source Beutler Lab
Gene Symbol Cep85
Ensembl Gene ENSMUSG00000037443
Gene Namecentrosomal protein 85
Synonyms2410030J07Rik, Ccdc21
MMRRC Submission 040218-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R2216 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134129858-134187112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134131430 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 710 (H710R)
Ref Sequence ENSEMBL: ENSMUSP00000113351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030651] [ENSMUST00000040271] [ENSMUST00000070246] [ENSMUST00000074690] [ENSMUST00000105879] [ENSMUST00000121566] [ENSMUST00000151113]
AlphaFold Q8BMK0
Predicted Effect probably benign
Transcript: ENSMUST00000030651
SMART Domains Protein: ENSMUSP00000030651
Gene: ENSMUSG00000028843

DomainStartEndE-ValueType
Pfam:SH3BGR 2 93 6.3e-40 PFAM
Pfam:Glutaredoxin 22 70 9.2e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000040271
AA Change: H712R

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039889
Gene: ENSMUSG00000037443
AA Change: H712R

DomainStartEndE-ValueType
coiled coil region 333 656 N/A INTRINSIC
coiled coil region 725 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070246
SMART Domains Protein: ENSMUSP00000064030
Gene: ENSMUSG00000012126

DomainStartEndE-ValueType
Pfam:SEP 114 185 1.5e-20 PFAM
UBX 268 350 2.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074690
SMART Domains Protein: ENSMUSP00000074255
Gene: ENSMUSG00000012126

DomainStartEndE-ValueType
coiled coil region 69 147 N/A INTRINSIC
Pfam:SEP 232 303 7.9e-20 PFAM
UBX 386 468 2.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105879
Predicted Effect possibly damaging
Transcript: ENSMUST00000121566
AA Change: H710R

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113351
Gene: ENSMUSG00000037443
AA Change: H710R

DomainStartEndE-ValueType
coiled coil region 331 654 N/A INTRINSIC
coiled coil region 723 747 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139616
Predicted Effect probably benign
Transcript: ENSMUST00000151113
SMART Domains Protein: ENSMUSP00000122892
Gene: ENSMUSG00000012126

DomainStartEndE-ValueType
Blast:SEP 15 64 2e-13 BLAST
SCOP:d1i42a_ 129 173 4e-5 SMART
Blast:UBX 135 174 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156323
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centrosome-associated family of proteins. The centrosome is a subcellular organelle in the animal cell that functions as a microtubule organizing center and is involved in cell-cycle progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 72,031,446 P146T probably damaging Het
Arnt2 T A 7: 84,275,351 T423S probably damaging Het
Bend5 A G 4: 111,448,590 N277S probably null Het
Cd22 G T 7: 30,867,046 T816N probably damaging Het
Cep126 G A 9: 8,120,678 R115C probably damaging Het
Cmya5 A T 13: 93,093,495 L1695H probably damaging Het
Col24a1 T C 3: 145,314,981 V371A probably benign Het
Csmd1 T A 8: 17,027,339 probably null Het
Cyp1a1 T A 9: 57,702,069 probably null Het
Dennd1c C T 17: 57,074,492 probably null Het
Dmxl1 G A 18: 49,893,923 V2033I probably benign Het
Dtna A G 18: 23,569,565 H51R probably damaging Het
Dysf G A 6: 84,207,245 probably null Het
Gcn1l1 T A 5: 115,593,661 V945E probably benign Het
Gm12800 T A 4: 101,910,060 W169R probably damaging Het
Gpbar1 C G 1: 74,278,894 L99V probably damaging Het
Hdac9 A T 12: 34,429,517 D212E probably damaging Het
Itga1 A T 13: 114,997,029 D448E probably benign Het
Itga2b T A 11: 102,467,866 N75I probably benign Het
Klra7 T C 6: 130,228,586 E117G probably benign Het
Kmt2b G A 7: 30,574,065 R2349C probably benign Het
Masp1 T C 16: 23,492,055 N209S probably benign Het
Mybpc2 C T 7: 44,512,500 probably null Het
Myh15 C G 16: 49,165,838 S1557* probably null Het
Myo3a A C 2: 22,577,771 T346P probably benign Het
Nim1k A G 13: 119,714,215 Y152H probably damaging Het
Nrp2 C T 1: 62,762,918 R507* probably null Het
Olfr513 C T 7: 108,755,612 T252M probably damaging Het
Olfr702 T A 7: 106,823,998 H176L probably damaging Het
Parp14 T C 16: 35,857,205 I798V probably benign Het
Pcnx2 C T 8: 125,888,077 A212T probably benign Het
Pkhd1l1 A T 15: 44,573,895 H3522L probably damaging Het
Pram1 C T 17: 33,641,284 A275V probably benign Het
Prkag1 A T 15: 98,815,946 M1K probably null Het
Prss52 T C 14: 64,113,593 S276P probably damaging Het
Ranbp17 A T 11: 33,481,125 V284D probably damaging Het
Reln T C 5: 22,048,005 D648G probably benign Het
Rnf112 A G 11: 61,452,279 L190P probably damaging Het
Scn5a G T 9: 119,485,612 P2010Q probably benign Het
Scn5a T C 9: 119,513,085 Y1138C probably benign Het
Slc4a9 A G 18: 36,530,745 H274R probably benign Het
Slc5a6 T G 5: 31,039,335 E391D possibly damaging Het
Speer2 T C 16: 69,858,842 Q32R possibly damaging Het
Tars A G 15: 11,389,708 V372A probably benign Het
Thsd7a A T 6: 12,337,268 L1250Q possibly damaging Het
Tnnt3 A G 7: 142,512,564 Y222C probably benign Het
Trim40 T C 17: 36,888,983 I68V probably benign Het
Trp53tg5 T C 2: 164,471,306 I150V probably benign Het
Ube2u T C 4: 100,532,168 V109A probably benign Het
Usp54 A T 14: 20,561,840 D969E probably benign Het
Vil1 G T 1: 74,425,679 R495L probably benign Het
Wfs1 T A 5: 36,967,220 K700* probably null Het
Zcchc8 A G 5: 123,707,403 L298P probably damaging Het
Zfp946 A T 17: 22,454,716 Q150H possibly damaging Het
Other mutations in Cep85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cep85 APN 4 134148761 missense possibly damaging 0.63
IGL01397:Cep85 APN 4 134156206 missense probably damaging 1.00
IGL01472:Cep85 APN 4 134134166 missense possibly damaging 0.55
IGL01522:Cep85 APN 4 134152255 missense probably damaging 1.00
IGL01522:Cep85 APN 4 134152256 missense probably damaging 1.00
IGL02004:Cep85 APN 4 134167387 missense probably damaging 1.00
IGL02043:Cep85 APN 4 134155727 missense probably benign 0.02
IGL02187:Cep85 APN 4 134131305 missense possibly damaging 0.86
IGL02317:Cep85 APN 4 134155811 missense probably damaging 1.00
IGL02543:Cep85 APN 4 134156323 missense possibly damaging 0.52
1mM(1):Cep85 UTSW 4 134156264 missense possibly damaging 0.88
PIT4468001:Cep85 UTSW 4 134148697 missense probably damaging 1.00
R0060:Cep85 UTSW 4 134167300 missense probably damaging 1.00
R0068:Cep85 UTSW 4 134154295 missense probably benign 0.00
R0346:Cep85 UTSW 4 134132422 missense probably damaging 1.00
R0462:Cep85 UTSW 4 134131421 missense possibly damaging 0.88
R1295:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1296:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1472:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1577:Cep85 UTSW 4 134152288 missense probably damaging 1.00
R1681:Cep85 UTSW 4 134148728 nonsense probably null
R1687:Cep85 UTSW 4 134148013 missense probably benign 0.00
R2031:Cep85 UTSW 4 134132450 missense probably benign 0.00
R2220:Cep85 UTSW 4 134153867 missense probably damaging 1.00
R4321:Cep85 UTSW 4 134132285 missense probably damaging 1.00
R4888:Cep85 UTSW 4 134164751 intron probably benign
R5044:Cep85 UTSW 4 134156179 missense probably damaging 0.97
R5075:Cep85 UTSW 4 134132367 missense probably damaging 1.00
R5627:Cep85 UTSW 4 134134097 missense probably damaging 1.00
R6841:Cep85 UTSW 4 134155856 missense probably benign
R6842:Cep85 UTSW 4 134155856 missense probably benign
R6843:Cep85 UTSW 4 134155856 missense probably benign
R6981:Cep85 UTSW 4 134152261 missense probably damaging 1.00
R7252:Cep85 UTSW 4 134148031 missense probably benign 0.12
R7869:Cep85 UTSW 4 134132298 missense probably damaging 0.99
R8057:Cep85 UTSW 4 134153614 unclassified probably benign
R8194:Cep85 UTSW 4 134134089 missense probably null 0.00
R8733:Cep85 UTSW 4 134148161 missense possibly damaging 0.87
R8928:Cep85 UTSW 4 134132404 missense probably benign 0.00
V8831:Cep85 UTSW 4 134156069 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCTGAAGGCAGAACTCTCAG -3'
(R):5'- GCTTGTAGTAGAGACTTTACTATGTGC -3'

Sequencing Primer
(F):5'- AAGGAACCTTCTGGCGAGGC -3'
(R):5'- TACTATGTGCAAAGCCCTGG -3'
Posted On2014-10-15