Mutagenetix > Incidental Mutations

Incidental Mutation 'R2216:Cep85'

241142

Institutional Source

Beutler Lab

Gene Symbol

Cep85

Ensembl Gene

ENSMUSG00000037443

Gene Name

centrosomal protein 85

Synonyms

2410030J07Rik, Ccdc21

MMRRC Submission

040218-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R2216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134129858-134187112 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134131430 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 710 (H710R)

Ref Sequence

ENSEMBL: ENSMUSP00000113351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030651] [ENSMUST00000040271] [ENSMUST00000070246] [ENSMUST00000074690] [ENSMUST00000105879] [ENSMUST00000121566] [ENSMUST00000151113]

AlphaFold

Q8BMK0

Predicted Effect

probably benign
Transcript: ENSMUST00000030651

SMART Domains

Protein: ENSMUSP00000030651
Gene: ENSMUSG00000028843

Domain	Start	End	E-Value	Type
Pfam:SH3BGR	2	93	6.3e-40	PFAM
Pfam:Glutaredoxin	22	70	9.2e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040271
AA Change: H712R

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000039889
Gene: ENSMUSG00000037443
AA Change: H712R

Domain	Start	End	E-Value	Type
coiled coil region	333	656	N/A	INTRINSIC
coiled coil region	725	749	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000070246

SMART Domains

Protein: ENSMUSP00000064030
Gene: ENSMUSG00000012126

Domain	Start	End	E-Value	Type
Pfam:SEP	114	185	1.5e-20	PFAM
UBX	268	350	2.3e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000074690

SMART Domains

Protein: ENSMUSP00000074255
Gene: ENSMUSG00000012126

Domain	Start	End	E-Value	Type
coiled coil region	69	147	N/A	INTRINSIC
Pfam:SEP	232	303	7.9e-20	PFAM
UBX	386	468	2.3e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105879

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121566
AA Change: H710R

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000113351
Gene: ENSMUSG00000037443
AA Change: H710R

Domain	Start	End	E-Value	Type
coiled coil region	331	654	N/A	INTRINSIC
coiled coil region	723	747	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138144

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139616

Predicted Effect

probably benign
Transcript: ENSMUST00000151113

SMART Domains

Protein: ENSMUSP00000122892
Gene: ENSMUSG00000012126

Domain	Start	End	E-Value	Type
Blast:SEP	15	64	2e-13	BLAST
SCOP:d1i42a_	129	173	4e-5	SMART
Blast:UBX	135	174	1e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151407

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156323

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centrosome-associated family of proteins. The centrosome is a subcellular organelle in the animal cell that functions as a microtubule organizing center and is involved in cell-cycle progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aipl1	G	T	11: 72,031,446	P146T	probably damaging	Het
Arnt2	T	A	7: 84,275,351	T423S	probably damaging	Het
Bend5	A	G	4: 111,448,590	N277S	probably null	Het
Cd22	G	T	7: 30,867,046	T816N	probably damaging	Het
Cep126	G	A	9: 8,120,678	R115C	probably damaging	Het
Cmya5	A	T	13: 93,093,495	L1695H	probably damaging	Het
Col24a1	T	C	3: 145,314,981	V371A	probably benign	Het
Csmd1	T	A	8: 17,027,339		probably null	Het
Cyp1a1	T	A	9: 57,702,069		probably null	Het
Dennd1c	C	T	17: 57,074,492		probably null	Het
Dmxl1	G	A	18: 49,893,923	V2033I	probably benign	Het
Dtna	A	G	18: 23,569,565	H51R	probably damaging	Het
Dysf	G	A	6: 84,207,245		probably null	Het
Gcn1l1	T	A	5: 115,593,661	V945E	probably benign	Het
Gm12800	T	A	4: 101,910,060	W169R	probably damaging	Het
Gpbar1	C	G	1: 74,278,894	L99V	probably damaging	Het
Hdac9	A	T	12: 34,429,517	D212E	probably damaging	Het
Itga1	A	T	13: 114,997,029	D448E	probably benign	Het
Itga2b	T	A	11: 102,467,866	N75I	probably benign	Het
Klra7	T	C	6: 130,228,586	E117G	probably benign	Het
Kmt2b	G	A	7: 30,574,065	R2349C	probably benign	Het
Masp1	T	C	16: 23,492,055	N209S	probably benign	Het
Mybpc2	C	T	7: 44,512,500		probably null	Het
Myh15	C	G	16: 49,165,838	S1557*	probably null	Het
Myo3a	A	C	2: 22,577,771	T346P	probably benign	Het
Nim1k	A	G	13: 119,714,215	Y152H	probably damaging	Het
Nrp2	C	T	1: 62,762,918	R507*	probably null	Het
Olfr513	C	T	7: 108,755,612	T252M	probably damaging	Het
Olfr702	T	A	7: 106,823,998	H176L	probably damaging	Het
Parp14	T	C	16: 35,857,205	I798V	probably benign	Het
Pcnx2	C	T	8: 125,888,077	A212T	probably benign	Het
Pkhd1l1	A	T	15: 44,573,895	H3522L	probably damaging	Het
Pram1	C	T	17: 33,641,284	A275V	probably benign	Het
Prkag1	A	T	15: 98,815,946	M1K	probably null	Het
Prss52	T	C	14: 64,113,593	S276P	probably damaging	Het
Ranbp17	A	T	11: 33,481,125	V284D	probably damaging	Het
Reln	T	C	5: 22,048,005	D648G	probably benign	Het
Rnf112	A	G	11: 61,452,279	L190P	probably damaging	Het
Scn5a	G	T	9: 119,485,612	P2010Q	probably benign	Het
Scn5a	T	C	9: 119,513,085	Y1138C	probably benign	Het
Slc4a9	A	G	18: 36,530,745	H274R	probably benign	Het
Slc5a6	T	G	5: 31,039,335	E391D	possibly damaging	Het
Speer2	T	C	16: 69,858,842	Q32R	possibly damaging	Het
Tars	A	G	15: 11,389,708	V372A	probably benign	Het
Thsd7a	A	T	6: 12,337,268	L1250Q	possibly damaging	Het
Tnnt3	A	G	7: 142,512,564	Y222C	probably benign	Het
Trim40	T	C	17: 36,888,983	I68V	probably benign	Het
Trp53tg5	T	C	2: 164,471,306	I150V	probably benign	Het
Ube2u	T	C	4: 100,532,168	V109A	probably benign	Het
Usp54	A	T	14: 20,561,840	D969E	probably benign	Het
Vil1	G	T	1: 74,425,679	R495L	probably benign	Het
Wfs1	T	A	5: 36,967,220	K700*	probably null	Het
Zcchc8	A	G	5: 123,707,403	L298P	probably damaging	Het
Zfp946	A	T	17: 22,454,716	Q150H	possibly damaging	Het

Other mutations in Cep85

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Cep85	APN	4	134148761	missense	possibly damaging	0.63
IGL01397:Cep85	APN	4	134156206	missense	probably damaging	1.00
IGL01472:Cep85	APN	4	134134166	missense	possibly damaging	0.55
IGL01522:Cep85	APN	4	134152255	missense	probably damaging	1.00
IGL01522:Cep85	APN	4	134152256	missense	probably damaging	1.00
IGL02004:Cep85	APN	4	134167387	missense	probably damaging	1.00
IGL02043:Cep85	APN	4	134155727	missense	probably benign	0.02
IGL02187:Cep85	APN	4	134131305	missense	possibly damaging	0.86
IGL02317:Cep85	APN	4	134155811	missense	probably damaging	1.00
IGL02543:Cep85	APN	4	134156323	missense	possibly damaging	0.52
1mM(1):Cep85	UTSW	4	134156264	missense	possibly damaging	0.88
PIT4468001:Cep85	UTSW	4	134148697	missense	probably damaging	1.00
R0060:Cep85	UTSW	4	134167300	missense	probably damaging	1.00
R0068:Cep85	UTSW	4	134154295	missense	probably benign	0.00
R0346:Cep85	UTSW	4	134132422	missense	probably damaging	1.00
R0462:Cep85	UTSW	4	134131421	missense	possibly damaging	0.88
R1295:Cep85	UTSW	4	134167400	missense	probably damaging	1.00
R1296:Cep85	UTSW	4	134167400	missense	probably damaging	1.00
R1472:Cep85	UTSW	4	134167400	missense	probably damaging	1.00
R1577:Cep85	UTSW	4	134152288	missense	probably damaging	1.00
R1681:Cep85	UTSW	4	134148728	nonsense	probably null
R1687:Cep85	UTSW	4	134148013	missense	probably benign	0.00
R2031:Cep85	UTSW	4	134132450	missense	probably benign	0.00
R2220:Cep85	UTSW	4	134153867	missense	probably damaging	1.00
R4321:Cep85	UTSW	4	134132285	missense	probably damaging	1.00
R4888:Cep85	UTSW	4	134164751	intron	probably benign
R5044:Cep85	UTSW	4	134156179	missense	probably damaging	0.97
R5075:Cep85	UTSW	4	134132367	missense	probably damaging	1.00
R5627:Cep85	UTSW	4	134134097	missense	probably damaging	1.00
R6841:Cep85	UTSW	4	134155856	missense	probably benign
R6842:Cep85	UTSW	4	134155856	missense	probably benign
R6843:Cep85	UTSW	4	134155856	missense	probably benign
R6981:Cep85	UTSW	4	134152261	missense	probably damaging	1.00
R7252:Cep85	UTSW	4	134148031	missense	probably benign	0.12
R7869:Cep85	UTSW	4	134132298	missense	probably damaging	0.99
R8057:Cep85	UTSW	4	134153614	unclassified	probably benign
R8194:Cep85	UTSW	4	134134089	missense	probably null	0.00
R8733:Cep85	UTSW	4	134148161	missense	possibly damaging	0.87
R8928:Cep85	UTSW	4	134132404	missense	probably benign	0.00
V8831:Cep85	UTSW	4	134156069	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGCTGAAGGCAGAACTCTCAG -3'
(R):5'- GCTTGTAGTAGAGACTTTACTATGTGC -3'

Sequencing Primer
(F):5'- AAGGAACCTTCTGGCGAGGC -3'
(R):5'- TACTATGTGCAAAGCCCTGG -3'

Posted On

2014-10-15