Incidental Mutation 'R2216:Cep85'
ID 241142
Institutional Source Beutler Lab
Gene Symbol Cep85
Ensembl Gene ENSMUSG00000037443
Gene Name centrosomal protein 85
Synonyms Ccdc21, 2410030J07Rik
MMRRC Submission 040218-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.943) question?
Stock # R2216 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 133857169-133914420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 133858741 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 710 (H710R)
Ref Sequence ENSEMBL: ENSMUSP00000113351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030651] [ENSMUST00000040271] [ENSMUST00000070246] [ENSMUST00000074690] [ENSMUST00000105879] [ENSMUST00000121566] [ENSMUST00000151113]
AlphaFold Q8BMK0
Predicted Effect probably benign
Transcript: ENSMUST00000030651
SMART Domains Protein: ENSMUSP00000030651
Gene: ENSMUSG00000028843

DomainStartEndE-ValueType
Pfam:SH3BGR 2 93 6.3e-40 PFAM
Pfam:Glutaredoxin 22 70 9.2e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000040271
AA Change: H712R

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039889
Gene: ENSMUSG00000037443
AA Change: H712R

DomainStartEndE-ValueType
coiled coil region 333 656 N/A INTRINSIC
coiled coil region 725 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070246
SMART Domains Protein: ENSMUSP00000064030
Gene: ENSMUSG00000012126

DomainStartEndE-ValueType
Pfam:SEP 114 185 1.5e-20 PFAM
UBX 268 350 2.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074690
SMART Domains Protein: ENSMUSP00000074255
Gene: ENSMUSG00000012126

DomainStartEndE-ValueType
coiled coil region 69 147 N/A INTRINSIC
Pfam:SEP 232 303 7.9e-20 PFAM
UBX 386 468 2.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105879
Predicted Effect possibly damaging
Transcript: ENSMUST00000121566
AA Change: H710R

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113351
Gene: ENSMUSG00000037443
AA Change: H710R

DomainStartEndE-ValueType
coiled coil region 331 654 N/A INTRINSIC
coiled coil region 723 747 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156323
Predicted Effect probably benign
Transcript: ENSMUST00000151113
SMART Domains Protein: ENSMUSP00000122892
Gene: ENSMUSG00000012126

DomainStartEndE-ValueType
Blast:SEP 15 64 2e-13 BLAST
SCOP:d1i42a_ 129 173 4e-5 SMART
Blast:UBX 135 174 1e-20 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centrosome-associated family of proteins. The centrosome is a subcellular organelle in the animal cell that functions as a microtubule organizing center and is involved in cell-cycle progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 71,922,272 (GRCm39) P146T probably damaging Het
Arnt2 T A 7: 83,924,559 (GRCm39) T423S probably damaging Het
Bend5 A G 4: 111,305,787 (GRCm39) N277S probably null Het
Cd22 G T 7: 30,566,471 (GRCm39) T816N probably damaging Het
Cep126 G A 9: 8,120,679 (GRCm39) R115C probably damaging Het
Cmya5 A T 13: 93,230,003 (GRCm39) L1695H probably damaging Het
Col24a1 T C 3: 145,020,742 (GRCm39) V371A probably benign Het
Csmd1 T A 8: 17,077,355 (GRCm39) probably null Het
Cyp1a1 T A 9: 57,609,352 (GRCm39) probably null Het
Dennd1c C T 17: 57,381,492 (GRCm39) probably null Het
Dmxl1 G A 18: 50,026,990 (GRCm39) V2033I probably benign Het
Dtna A G 18: 23,702,622 (GRCm39) H51R probably damaging Het
Dysf G A 6: 84,184,227 (GRCm39) probably null Het
Gcn1 T A 5: 115,731,720 (GRCm39) V945E probably benign Het
Gpbar1 C G 1: 74,318,053 (GRCm39) L99V probably damaging Het
Hdac9 A T 12: 34,479,516 (GRCm39) D212E probably damaging Het
Itga1 A T 13: 115,133,565 (GRCm39) D448E probably benign Het
Itga2b T A 11: 102,358,692 (GRCm39) N75I probably benign Het
Klra7 T C 6: 130,205,549 (GRCm39) E117G probably benign Het
Kmt2b G A 7: 30,273,490 (GRCm39) R2349C probably benign Het
Masp1 T C 16: 23,310,805 (GRCm39) N209S probably benign Het
Mybpc2 C T 7: 44,161,924 (GRCm39) probably null Het
Myh15 C G 16: 48,986,201 (GRCm39) S1557* probably null Het
Myo3a A C 2: 22,467,783 (GRCm39) T346P probably benign Het
Nim1k A G 13: 120,175,751 (GRCm39) Y152H probably damaging Het
Nrp2 C T 1: 62,802,077 (GRCm39) R507* probably null Het
Or13n4 T A 7: 106,423,205 (GRCm39) H176L probably damaging Het
Or5e1 C T 7: 108,354,819 (GRCm39) T252M probably damaging Het
Parp14 T C 16: 35,677,575 (GRCm39) I798V probably benign Het
Pcnx2 C T 8: 126,614,816 (GRCm39) A212T probably benign Het
Pkhd1l1 A T 15: 44,437,291 (GRCm39) H3522L probably damaging Het
Pram1 C T 17: 33,860,258 (GRCm39) A275V probably benign Het
Pramel18 T A 4: 101,767,257 (GRCm39) W169R probably damaging Het
Prkag1 A T 15: 98,713,827 (GRCm39) M1K probably null Het
Prss52 T C 14: 64,351,042 (GRCm39) S276P probably damaging Het
Ranbp17 A T 11: 33,431,125 (GRCm39) V284D probably damaging Het
Reln T C 5: 22,253,003 (GRCm39) D648G probably benign Het
Rnf112 A G 11: 61,343,105 (GRCm39) L190P probably damaging Het
Scn5a G T 9: 119,314,678 (GRCm39) P2010Q probably benign Het
Scn5a T C 9: 119,342,151 (GRCm39) Y1138C probably benign Het
Slc4a9 A G 18: 36,663,798 (GRCm39) H274R probably benign Het
Slc5a6 T G 5: 31,196,679 (GRCm39) E391D possibly damaging Het
Speer2 T C 16: 69,655,730 (GRCm39) Q32R possibly damaging Het
Tars1 A G 15: 11,389,794 (GRCm39) V372A probably benign Het
Thsd7a A T 6: 12,337,267 (GRCm39) L1250Q possibly damaging Het
Tnnt3 A G 7: 142,066,301 (GRCm39) Y222C probably benign Het
Trim40 T C 17: 37,199,875 (GRCm39) I68V probably benign Het
Trp53tg5 T C 2: 164,313,226 (GRCm39) I150V probably benign Het
Ube2u T C 4: 100,389,365 (GRCm39) V109A probably benign Het
Usp54 A T 14: 20,611,908 (GRCm39) D969E probably benign Het
Vil1 G T 1: 74,464,838 (GRCm39) R495L probably benign Het
Wfs1 T A 5: 37,124,564 (GRCm39) K700* probably null Het
Zcchc8 A G 5: 123,845,466 (GRCm39) L298P probably damaging Het
Zfp946 A T 17: 22,673,697 (GRCm39) Q150H possibly damaging Het
Other mutations in Cep85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cep85 APN 4 133,876,072 (GRCm39) missense possibly damaging 0.63
IGL01397:Cep85 APN 4 133,883,517 (GRCm39) missense probably damaging 1.00
IGL01472:Cep85 APN 4 133,861,477 (GRCm39) missense possibly damaging 0.55
IGL01522:Cep85 APN 4 133,879,567 (GRCm39) missense probably damaging 1.00
IGL01522:Cep85 APN 4 133,879,566 (GRCm39) missense probably damaging 1.00
IGL02004:Cep85 APN 4 133,894,698 (GRCm39) missense probably damaging 1.00
IGL02043:Cep85 APN 4 133,883,038 (GRCm39) missense probably benign 0.02
IGL02187:Cep85 APN 4 133,858,616 (GRCm39) missense possibly damaging 0.86
IGL02317:Cep85 APN 4 133,883,122 (GRCm39) missense probably damaging 1.00
IGL02543:Cep85 APN 4 133,883,634 (GRCm39) missense possibly damaging 0.52
1mM(1):Cep85 UTSW 4 133,883,575 (GRCm39) missense possibly damaging 0.88
PIT4468001:Cep85 UTSW 4 133,876,008 (GRCm39) missense probably damaging 1.00
R0060:Cep85 UTSW 4 133,894,611 (GRCm39) missense probably damaging 1.00
R0068:Cep85 UTSW 4 133,881,606 (GRCm39) missense probably benign 0.00
R0346:Cep85 UTSW 4 133,859,733 (GRCm39) missense probably damaging 1.00
R0462:Cep85 UTSW 4 133,858,732 (GRCm39) missense possibly damaging 0.88
R1295:Cep85 UTSW 4 133,894,711 (GRCm39) missense probably damaging 1.00
R1296:Cep85 UTSW 4 133,894,711 (GRCm39) missense probably damaging 1.00
R1472:Cep85 UTSW 4 133,894,711 (GRCm39) missense probably damaging 1.00
R1577:Cep85 UTSW 4 133,879,599 (GRCm39) missense probably damaging 1.00
R1681:Cep85 UTSW 4 133,876,039 (GRCm39) nonsense probably null
R1687:Cep85 UTSW 4 133,875,324 (GRCm39) missense probably benign 0.00
R2031:Cep85 UTSW 4 133,859,761 (GRCm39) missense probably benign 0.00
R2220:Cep85 UTSW 4 133,881,178 (GRCm39) missense probably damaging 1.00
R4321:Cep85 UTSW 4 133,859,596 (GRCm39) missense probably damaging 1.00
R4888:Cep85 UTSW 4 133,892,062 (GRCm39) intron probably benign
R5044:Cep85 UTSW 4 133,883,490 (GRCm39) missense probably damaging 0.97
R5075:Cep85 UTSW 4 133,859,678 (GRCm39) missense probably damaging 1.00
R5627:Cep85 UTSW 4 133,861,408 (GRCm39) missense probably damaging 1.00
R6841:Cep85 UTSW 4 133,883,167 (GRCm39) missense probably benign
R6842:Cep85 UTSW 4 133,883,167 (GRCm39) missense probably benign
R6843:Cep85 UTSW 4 133,883,167 (GRCm39) missense probably benign
R6981:Cep85 UTSW 4 133,879,572 (GRCm39) missense probably damaging 1.00
R7252:Cep85 UTSW 4 133,875,342 (GRCm39) missense probably benign 0.12
R7869:Cep85 UTSW 4 133,859,609 (GRCm39) missense probably damaging 0.99
R8057:Cep85 UTSW 4 133,880,925 (GRCm39) unclassified probably benign
R8194:Cep85 UTSW 4 133,861,400 (GRCm39) missense probably null 0.00
R8733:Cep85 UTSW 4 133,875,472 (GRCm39) missense possibly damaging 0.87
R8928:Cep85 UTSW 4 133,859,715 (GRCm39) missense probably benign 0.00
R9430:Cep85 UTSW 4 133,894,665 (GRCm39) missense probably damaging 1.00
R9550:Cep85 UTSW 4 133,858,598 (GRCm39) missense probably damaging 1.00
V8831:Cep85 UTSW 4 133,883,380 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCTGAAGGCAGAACTCTCAG -3'
(R):5'- GCTTGTAGTAGAGACTTTACTATGTGC -3'

Sequencing Primer
(F):5'- AAGGAACCTTCTGGCGAGGC -3'
(R):5'- TACTATGTGCAAAGCCCTGG -3'
Posted On 2014-10-15