Incidental Mutation 'R2216:Wfs1'
ID 241145
Institutional Source Beutler Lab
Gene Symbol Wfs1
Ensembl Gene ENSMUSG00000039474
Gene Name wolframin ER transmembrane glycoprotein
Synonyms wolframin, Wolfram syndrome 1 homolog (human)
MMRRC Submission 040218-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.416) question?
Stock # R2216 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 37123448-37146326 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 37124564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 700 (K700*)
Ref Sequence ENSEMBL: ENSMUSP00000132404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043964] [ENSMUST00000166339]
AlphaFold P56695
Predicted Effect probably null
Transcript: ENSMUST00000043964
AA Change: K776*
SMART Domains Protein: ENSMUSP00000048053
Gene: ENSMUSG00000039474
AA Change: K776*

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 1e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
transmembrane domain 313 335 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
transmembrane domain 495 517 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 561 583 N/A INTRINSIC
transmembrane domain 590 612 N/A INTRINSIC
transmembrane domain 632 654 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166339
AA Change: K700*
SMART Domains Protein: ENSMUSP00000132404
Gene: ENSMUSG00000039474
AA Change: K700*

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 3e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 556 578 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167937
SMART Domains Protein: ENSMUSP00000125779
Gene: ENSMUSG00000039474

DomainStartEndE-ValueType
Blast:SEL1 20 58 4e-9 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased pancreatic beta cells and impaired glucose tolerance. Mice homozygous for a knock-out allele exhibit impaired glucose tolerance, decreased body weight, and abnormal behavior associated with increased sensitivity to stress. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 71,922,272 (GRCm39) P146T probably damaging Het
Arnt2 T A 7: 83,924,559 (GRCm39) T423S probably damaging Het
Bend5 A G 4: 111,305,787 (GRCm39) N277S probably null Het
Cd22 G T 7: 30,566,471 (GRCm39) T816N probably damaging Het
Cep126 G A 9: 8,120,679 (GRCm39) R115C probably damaging Het
Cep85 T C 4: 133,858,741 (GRCm39) H710R possibly damaging Het
Cmya5 A T 13: 93,230,003 (GRCm39) L1695H probably damaging Het
Col24a1 T C 3: 145,020,742 (GRCm39) V371A probably benign Het
Csmd1 T A 8: 17,077,355 (GRCm39) probably null Het
Cyp1a1 T A 9: 57,609,352 (GRCm39) probably null Het
Dennd1c C T 17: 57,381,492 (GRCm39) probably null Het
Dmxl1 G A 18: 50,026,990 (GRCm39) V2033I probably benign Het
Dtna A G 18: 23,702,622 (GRCm39) H51R probably damaging Het
Dysf G A 6: 84,184,227 (GRCm39) probably null Het
Gcn1 T A 5: 115,731,720 (GRCm39) V945E probably benign Het
Gpbar1 C G 1: 74,318,053 (GRCm39) L99V probably damaging Het
Hdac9 A T 12: 34,479,516 (GRCm39) D212E probably damaging Het
Itga1 A T 13: 115,133,565 (GRCm39) D448E probably benign Het
Itga2b T A 11: 102,358,692 (GRCm39) N75I probably benign Het
Klra7 T C 6: 130,205,549 (GRCm39) E117G probably benign Het
Kmt2b G A 7: 30,273,490 (GRCm39) R2349C probably benign Het
Masp1 T C 16: 23,310,805 (GRCm39) N209S probably benign Het
Mybpc2 C T 7: 44,161,924 (GRCm39) probably null Het
Myh15 C G 16: 48,986,201 (GRCm39) S1557* probably null Het
Myo3a A C 2: 22,467,783 (GRCm39) T346P probably benign Het
Nim1k A G 13: 120,175,751 (GRCm39) Y152H probably damaging Het
Nrp2 C T 1: 62,802,077 (GRCm39) R507* probably null Het
Or13n4 T A 7: 106,423,205 (GRCm39) H176L probably damaging Het
Or5e1 C T 7: 108,354,819 (GRCm39) T252M probably damaging Het
Parp14 T C 16: 35,677,575 (GRCm39) I798V probably benign Het
Pcnx2 C T 8: 126,614,816 (GRCm39) A212T probably benign Het
Pkhd1l1 A T 15: 44,437,291 (GRCm39) H3522L probably damaging Het
Pram1 C T 17: 33,860,258 (GRCm39) A275V probably benign Het
Pramel18 T A 4: 101,767,257 (GRCm39) W169R probably damaging Het
Prkag1 A T 15: 98,713,827 (GRCm39) M1K probably null Het
Prss52 T C 14: 64,351,042 (GRCm39) S276P probably damaging Het
Ranbp17 A T 11: 33,431,125 (GRCm39) V284D probably damaging Het
Reln T C 5: 22,253,003 (GRCm39) D648G probably benign Het
Rnf112 A G 11: 61,343,105 (GRCm39) L190P probably damaging Het
Scn5a G T 9: 119,314,678 (GRCm39) P2010Q probably benign Het
Scn5a T C 9: 119,342,151 (GRCm39) Y1138C probably benign Het
Slc4a9 A G 18: 36,663,798 (GRCm39) H274R probably benign Het
Slc5a6 T G 5: 31,196,679 (GRCm39) E391D possibly damaging Het
Speer2 T C 16: 69,655,730 (GRCm39) Q32R possibly damaging Het
Tars1 A G 15: 11,389,794 (GRCm39) V372A probably benign Het
Thsd7a A T 6: 12,337,267 (GRCm39) L1250Q possibly damaging Het
Tnnt3 A G 7: 142,066,301 (GRCm39) Y222C probably benign Het
Trim40 T C 17: 37,199,875 (GRCm39) I68V probably benign Het
Trp53tg5 T C 2: 164,313,226 (GRCm39) I150V probably benign Het
Ube2u T C 4: 100,389,365 (GRCm39) V109A probably benign Het
Usp54 A T 14: 20,611,908 (GRCm39) D969E probably benign Het
Vil1 G T 1: 74,464,838 (GRCm39) R495L probably benign Het
Zcchc8 A G 5: 123,845,466 (GRCm39) L298P probably damaging Het
Zfp946 A T 17: 22,673,697 (GRCm39) Q150H possibly damaging Het
Other mutations in Wfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Wfs1 APN 5 37,125,261 (GRCm39) nonsense probably null
IGL01391:Wfs1 APN 5 37,128,907 (GRCm39) missense probably benign 0.10
IGL01788:Wfs1 APN 5 37,125,980 (GRCm39) missense probably benign 0.01
IGL02169:Wfs1 APN 5 37,125,823 (GRCm39) missense probably damaging 0.99
IGL02814:Wfs1 APN 5 37,125,013 (GRCm39) missense possibly damaging 0.88
IGL03294:Wfs1 APN 5 37,132,941 (GRCm39) missense probably damaging 1.00
IGL03299:Wfs1 APN 5 37,125,731 (GRCm39) nonsense probably null
2107:Wfs1 UTSW 5 37,124,617 (GRCm39) missense probably damaging 1.00
R0077:Wfs1 UTSW 5 37,130,538 (GRCm39) missense probably damaging 1.00
R0180:Wfs1 UTSW 5 37,124,372 (GRCm39) missense probably damaging 0.96
R0402:Wfs1 UTSW 5 37,134,324 (GRCm39) unclassified probably benign
R0458:Wfs1 UTSW 5 37,126,013 (GRCm39) missense probably damaging 0.98
R0533:Wfs1 UTSW 5 37,131,066 (GRCm39) splice site probably benign
R0890:Wfs1 UTSW 5 37,132,888 (GRCm39) missense probably damaging 1.00
R0948:Wfs1 UTSW 5 37,124,905 (GRCm39) missense probably damaging 1.00
R1413:Wfs1 UTSW 5 37,139,422 (GRCm39) missense possibly damaging 0.65
R1759:Wfs1 UTSW 5 37,124,359 (GRCm39) missense probably damaging 0.99
R2009:Wfs1 UTSW 5 37,125,653 (GRCm39) missense probably damaging 0.96
R2137:Wfs1 UTSW 5 37,124,845 (GRCm39) missense probably damaging 0.99
R2157:Wfs1 UTSW 5 37,125,286 (GRCm39) missense probably damaging 1.00
R3779:Wfs1 UTSW 5 37,125,968 (GRCm39) missense probably benign 0.01
R3850:Wfs1 UTSW 5 37,125,968 (GRCm39) missense probably benign 0.01
R3853:Wfs1 UTSW 5 37,125,968 (GRCm39) missense probably benign 0.01
R3918:Wfs1 UTSW 5 37,125,968 (GRCm39) missense probably benign 0.01
R4093:Wfs1 UTSW 5 37,124,809 (GRCm39) missense probably damaging 0.97
R5056:Wfs1 UTSW 5 37,132,931 (GRCm39) missense probably benign 0.00
R5849:Wfs1 UTSW 5 37,130,608 (GRCm39) missense probably damaging 1.00
R5997:Wfs1 UTSW 5 37,125,094 (GRCm39) missense probably damaging 0.99
R6666:Wfs1 UTSW 5 37,124,963 (GRCm39) missense possibly damaging 0.94
R7024:Wfs1 UTSW 5 37,124,294 (GRCm39) missense probably damaging 1.00
R7157:Wfs1 UTSW 5 37,124,516 (GRCm39) missense probably benign 0.00
R7264:Wfs1 UTSW 5 37,125,190 (GRCm39) missense probably damaging 1.00
R7269:Wfs1 UTSW 5 37,125,134 (GRCm39) nonsense probably null
R7365:Wfs1 UTSW 5 37,125,076 (GRCm39) missense probably benign 0.33
R7657:Wfs1 UTSW 5 37,125,578 (GRCm39) missense probably benign 0.01
R8422:Wfs1 UTSW 5 37,131,219 (GRCm39) missense probably benign 0.17
R8427:Wfs1 UTSW 5 37,125,431 (GRCm39) missense probably damaging 1.00
R8446:Wfs1 UTSW 5 37,128,953 (GRCm39) missense probably benign 0.00
R8949:Wfs1 UTSW 5 37,124,287 (GRCm39) missense probably damaging 0.99
R9673:Wfs1 UTSW 5 37,125,113 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCCTTGAGCTCGAAGAC -3'
(R):5'- GACCGAGATCGACAACAGTG -3'

Sequencing Primer
(F):5'- AAGACGGGCCACTTGCTAC -3'
(R):5'- TCGACAACAGTGCTGAGTC -3'
Posted On 2014-10-15