Mutagenetix > Incidental Mutation

Incidental Mutation 'R2216:Wfs1'

241145

Institutional Source

Beutler Lab

Gene Symbol

Wfs1

Ensembl Gene

ENSMUSG00000039474

Gene Name

wolframin ER transmembrane glycoprotein

Synonyms

wolframin

MMRRC Submission

040218-MU

Accession Numbers

Genbank: NM_011716; MGI: 1328355

Is this an essential gene?

Possibly non essential (E-score: 0.494) question?

Stock #

R2216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36966104-36989205 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 36967220 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 700 (K700*)

Ref Sequence

ENSEMBL: ENSMUSP00000132404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043964] [ENSMUST00000166339]

AlphaFold

P56695

Predicted Effect

probably null
Transcript: ENSMUST00000043964
AA Change: K776*

SMART Domains

Protein: ENSMUSP00000048053
Gene: ENSMUSG00000039474
AA Change: K776*

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
low complexity region	50	67	N/A	INTRINSIC
Blast:SEL1	101	139	1e-8	BLAST
low complexity region	268	275	N/A	INTRINSIC
transmembrane domain	313	335	N/A	INTRINSIC
transmembrane domain	342	364	N/A	INTRINSIC
transmembrane domain	407	424	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
transmembrane domain	495	517	N/A	INTRINSIC
transmembrane domain	529	551	N/A	INTRINSIC
transmembrane domain	561	583	N/A	INTRINSIC
transmembrane domain	590	612	N/A	INTRINSIC
transmembrane domain	632	654	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166339
AA Change: K700*

SMART Domains

Protein: ENSMUSP00000132404
Gene: ENSMUSG00000039474
AA Change: K700*

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
low complexity region	50	67	N/A	INTRINSIC
Blast:SEL1	101	139	3e-8	BLAST
low complexity region	268	275	N/A	INTRINSIC
low complexity region	334	345	N/A	INTRINSIC
transmembrane domain	419	441	N/A	INTRINSIC
transmembrane domain	453	475	N/A	INTRINSIC
transmembrane domain	485	507	N/A	INTRINSIC
transmembrane domain	514	536	N/A	INTRINSIC
transmembrane domain	556	578	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167937

SMART Domains

Protein: ENSMUSP00000125779
Gene: ENSMUSG00000039474

Domain	Start	End	E-Value	Type
Blast:SEL1	20	58	4e-9	BLAST

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased pancreatic beta cells and impaired glucose tolerance. Mice homozygous for a knock-out allele exhibit impaired glucose tolerance, decreased body weight, and abnormal behavior associated with increased sensitivity to stress. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(1)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aipl1	G	T	11: 72,031,446	P146T	probably damaging	Het
Arnt2	T	A	7: 84,275,351	T423S	probably damaging	Het
Bend5	A	G	4: 111,448,590	N277S	probably null	Het
Cd22	G	T	7: 30,867,046	T816N	probably damaging	Het
Cep126	G	A	9: 8,120,678	R115C	probably damaging	Het
Cep85	T	C	4: 134,131,430	H710R	possibly damaging	Het
Cmya5	A	T	13: 93,093,495	L1695H	probably damaging	Het
Col24a1	T	C	3: 145,314,981	V371A	probably benign	Het
Csmd1	T	A	8: 17,027,339		probably null	Het
Cyp1a1	T	A	9: 57,702,069		probably null	Het
Dennd1c	C	T	17: 57,074,492		probably null	Het
Dmxl1	G	A	18: 49,893,923	V2033I	probably benign	Het
Dtna	A	G	18: 23,569,565	H51R	probably damaging	Het
Dysf	G	A	6: 84,207,245		probably null	Het
Gcn1l1	T	A	5: 115,593,661	V945E	probably benign	Het
Gm12800	T	A	4: 101,910,060	W169R	probably damaging	Het
Gpbar1	C	G	1: 74,278,894	L99V	probably damaging	Het
Hdac9	A	T	12: 34,429,517	D212E	probably damaging	Het
Itga1	A	T	13: 114,997,029	D448E	probably benign	Het
Itga2b	T	A	11: 102,467,866	N75I	probably benign	Het
Klra7	T	C	6: 130,228,586	E117G	probably benign	Het
Kmt2b	G	A	7: 30,574,065	R2349C	probably benign	Het
Masp1	T	C	16: 23,492,055	N209S	probably benign	Het
Mybpc2	C	T	7: 44,512,500		probably null	Het
Myh15	C	G	16: 49,165,838	S1557*	probably null	Het
Myo3a	A	C	2: 22,577,771	T346P	probably benign	Het
Nim1k	A	G	13: 119,714,215	Y152H	probably damaging	Het
Nrp2	C	T	1: 62,762,918	R507*	probably null	Het
Olfr513	C	T	7: 108,755,612	T252M	probably damaging	Het
Olfr702	T	A	7: 106,823,998	H176L	probably damaging	Het
Parp14	T	C	16: 35,857,205	I798V	probably benign	Het
Pcnx2	C	T	8: 125,888,077	A212T	probably benign	Het
Pkhd1l1	A	T	15: 44,573,895	H3522L	probably damaging	Het
Pram1	C	T	17: 33,641,284	A275V	probably benign	Het
Prkag1	A	T	15: 98,815,946	M1K	probably null	Het
Prss52	T	C	14: 64,113,593	S276P	probably damaging	Het
Ranbp17	A	T	11: 33,481,125	V284D	probably damaging	Het
Reln	T	C	5: 22,048,005	D648G	probably benign	Het
Rnf112	A	G	11: 61,452,279	L190P	probably damaging	Het
Scn5a	G	T	9: 119,485,612	P2010Q	probably benign	Het
Scn5a	T	C	9: 119,513,085	Y1138C	probably benign	Het
Slc4a9	A	G	18: 36,530,745	H274R	probably benign	Het
Slc5a6	T	G	5: 31,039,335	E391D	possibly damaging	Het
Speer2	T	C	16: 69,858,842	Q32R	possibly damaging	Het
Tars	A	G	15: 11,389,708	V372A	probably benign	Het
Thsd7a	A	T	6: 12,337,268	L1250Q	possibly damaging	Het
Tnnt3	A	G	7: 142,512,564	Y222C	probably benign	Het
Trim40	T	C	17: 36,888,983	I68V	probably benign	Het
Trp53tg5	T	C	2: 164,471,306	I150V	probably benign	Het
Ube2u	T	C	4: 100,532,168	V109A	probably benign	Het
Usp54	A	T	14: 20,561,840	D969E	probably benign	Het
Vil1	G	T	1: 74,425,679	R495L	probably benign	Het
Zcchc8	A	G	5: 123,707,403	L298P	probably damaging	Het
Zfp946	A	T	17: 22,454,716	Q150H	possibly damaging	Het

Other mutations in Wfs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Wfs1	APN	5	36967917	nonsense	probably null
IGL01391:Wfs1	APN	5	36971563	missense	probably benign	0.10
IGL01788:Wfs1	APN	5	36968636	missense	probably benign	0.01
IGL02169:Wfs1	APN	5	36968479	missense	probably damaging	0.99
IGL02814:Wfs1	APN	5	36967669	missense	possibly damaging	0.88
IGL03294:Wfs1	APN	5	36975597	missense	probably damaging	1.00
IGL03299:Wfs1	APN	5	36968387	nonsense	probably null
2107:Wfs1	UTSW	5	36967273	missense	probably damaging	1.00
R0077:Wfs1	UTSW	5	36973194	missense	probably damaging	1.00
R0180:Wfs1	UTSW	5	36967028	missense	probably damaging	0.96
R0402:Wfs1	UTSW	5	36976980	unclassified	probably benign
R0458:Wfs1	UTSW	5	36968669	missense	probably damaging	0.98
R0533:Wfs1	UTSW	5	36973722	splice site	probably benign
R0890:Wfs1	UTSW	5	36975544	missense	probably damaging	1.00
R0948:Wfs1	UTSW	5	36967561	missense	probably damaging	1.00
R1413:Wfs1	UTSW	5	36982078	missense	possibly damaging	0.65
R1759:Wfs1	UTSW	5	36967015	missense	probably damaging	0.99
R2009:Wfs1	UTSW	5	36968309	missense	probably damaging	0.96
R2137:Wfs1	UTSW	5	36967501	missense	probably damaging	0.99
R2157:Wfs1	UTSW	5	36967942	missense	probably damaging	1.00
R3779:Wfs1	UTSW	5	36968624	missense	probably benign	0.01
R3850:Wfs1	UTSW	5	36968624	missense	probably benign	0.01
R3853:Wfs1	UTSW	5	36968624	missense	probably benign	0.01
R3918:Wfs1	UTSW	5	36968624	missense	probably benign	0.01
R4093:Wfs1	UTSW	5	36967465	missense	probably damaging	0.97
R5056:Wfs1	UTSW	5	36975587	missense	probably benign	0.00
R5849:Wfs1	UTSW	5	36973264	missense	probably damaging	1.00
R5997:Wfs1	UTSW	5	36967750	missense	probably damaging	0.99
R6666:Wfs1	UTSW	5	36967619	missense	possibly damaging	0.94
R7024:Wfs1	UTSW	5	36966950	missense	probably damaging	1.00
R7157:Wfs1	UTSW	5	36967172	missense	probably benign	0.00
R7264:Wfs1	UTSW	5	36967846	missense	probably damaging	1.00
R7269:Wfs1	UTSW	5	36967790	nonsense	probably null
R7365:Wfs1	UTSW	5	36967732	missense	probably benign	0.33
R7657:Wfs1	UTSW	5	36968234	missense	probably benign	0.01
R8422:Wfs1	UTSW	5	36973875	missense	probably benign	0.17
R8427:Wfs1	UTSW	5	36968087	missense	probably damaging	1.00
R8446:Wfs1	UTSW	5	36971609	missense	probably benign	0.00
R8949:Wfs1	UTSW	5	36966943	missense	probably damaging	0.99
R9673:Wfs1	UTSW	5	36967769	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGGCCTTGAGCTCGAAGAC -3'
(R):5'- GACCGAGATCGACAACAGTG -3'

Sequencing Primer
(F):5'- AAGACGGGCCACTTGCTAC -3'
(R):5'- TCGACAACAGTGCTGAGTC -3'

Posted On

2014-10-15