Mutagenetix > Incidental Mutation

Incidental Mutation 'R2216:Gcn1l1'

241146

Institutional Source

Beutler Lab

Gene Symbol

Gcn1l1

Ensembl Gene

ENSMUSG00000041638

Gene Name

GCN1 general control of amino-acid synthesis 1-like 1 (yeast)

Synonyms

GCN1L, G431004K08Rik

MMRRC Submission

040218-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.933) question?

Stock #

R2216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115565254-115622654 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115593661 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 945 (V945E)

Ref Sequence

ENSEMBL: ENSMUSP00000069432 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064454]

AlphaFold

E9PVA8

Predicted Effect

probably benign
Transcript: ENSMUST00000064454
AA Change: V945E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: V945E

Domain	Start	End	E-Value	Type
low complexity region	64	84	N/A	INTRINSIC
low complexity region	108	117	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
Pfam:DUF3554	357	705	2e-61	PFAM
coiled coil region	806	866	N/A	INTRINSIC
Blast:ARM	1028	1068	6e-11	BLAST
coiled coil region	1180	1203	N/A	INTRINSIC
low complexity region	1457	1466	N/A	INTRINSIC
low complexity region	1501	1510	N/A	INTRINSIC
ARM	1527	1567	3.69e1	SMART
Blast:ARM	1602	1644	1e-5	BLAST
Blast:EZ_HEAT	1671	1704	1e-7	BLAST
low complexity region	1926	1934	N/A	INTRINSIC
low complexity region	1956	1972	N/A	INTRINSIC
ARM	2034	2070	9.27e1	SMART
low complexity region	2326	2334	N/A	INTRINSIC
ARM	2416	2455	2.16e1	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aipl1	G	T	11: 72,031,446	P146T	probably damaging	Het
Arnt2	T	A	7: 84,275,351	T423S	probably damaging	Het
Bend5	A	G	4: 111,448,590	N277S	probably null	Het
Cd22	G	T	7: 30,867,046	T816N	probably damaging	Het
Cep126	G	A	9: 8,120,678	R115C	probably damaging	Het
Cep85	T	C	4: 134,131,430	H710R	possibly damaging	Het
Cmya5	A	T	13: 93,093,495	L1695H	probably damaging	Het
Col24a1	T	C	3: 145,314,981	V371A	probably benign	Het
Csmd1	T	A	8: 17,027,339		probably null	Het
Cyp1a1	T	A	9: 57,702,069		probably null	Het
Dennd1c	C	T	17: 57,074,492		probably null	Het
Dmxl1	G	A	18: 49,893,923	V2033I	probably benign	Het
Dtna	A	G	18: 23,569,565	H51R	probably damaging	Het
Dysf	G	A	6: 84,207,245		probably null	Het
Gm12800	T	A	4: 101,910,060	W169R	probably damaging	Het
Gpbar1	C	G	1: 74,278,894	L99V	probably damaging	Het
Hdac9	A	T	12: 34,429,517	D212E	probably damaging	Het
Itga1	A	T	13: 114,997,029	D448E	probably benign	Het
Itga2b	T	A	11: 102,467,866	N75I	probably benign	Het
Klra7	T	C	6: 130,228,586	E117G	probably benign	Het
Kmt2b	G	A	7: 30,574,065	R2349C	probably benign	Het
Masp1	T	C	16: 23,492,055	N209S	probably benign	Het
Mybpc2	C	T	7: 44,512,500		probably null	Het
Myh15	C	G	16: 49,165,838	S1557*	probably null	Het
Myo3a	A	C	2: 22,577,771	T346P	probably benign	Het
Nim1k	A	G	13: 119,714,215	Y152H	probably damaging	Het
Nrp2	C	T	1: 62,762,918	R507*	probably null	Het
Olfr513	C	T	7: 108,755,612	T252M	probably damaging	Het
Olfr702	T	A	7: 106,823,998	H176L	probably damaging	Het
Parp14	T	C	16: 35,857,205	I798V	probably benign	Het
Pcnx2	C	T	8: 125,888,077	A212T	probably benign	Het
Pkhd1l1	A	T	15: 44,573,895	H3522L	probably damaging	Het
Pram1	C	T	17: 33,641,284	A275V	probably benign	Het
Prkag1	A	T	15: 98,815,946	M1K	probably null	Het
Prss52	T	C	14: 64,113,593	S276P	probably damaging	Het
Ranbp17	A	T	11: 33,481,125	V284D	probably damaging	Het
Reln	T	C	5: 22,048,005	D648G	probably benign	Het
Rnf112	A	G	11: 61,452,279	L190P	probably damaging	Het
Scn5a	G	T	9: 119,485,612	P2010Q	probably benign	Het
Scn5a	T	C	9: 119,513,085	Y1138C	probably benign	Het
Slc4a9	A	G	18: 36,530,745	H274R	probably benign	Het
Slc5a6	T	G	5: 31,039,335	E391D	possibly damaging	Het
Speer2	T	C	16: 69,858,842	Q32R	possibly damaging	Het
Tars	A	G	15: 11,389,708	V372A	probably benign	Het
Thsd7a	A	T	6: 12,337,268	L1250Q	possibly damaging	Het
Tnnt3	A	G	7: 142,512,564	Y222C	probably benign	Het
Trim40	T	C	17: 36,888,983	I68V	probably benign	Het
Trp53tg5	T	C	2: 164,471,306	I150V	probably benign	Het
Ube2u	T	C	4: 100,532,168	V109A	probably benign	Het
Usp54	A	T	14: 20,561,840	D969E	probably benign	Het
Vil1	G	T	1: 74,425,679	R495L	probably benign	Het
Wfs1	T	A	5: 36,967,220	K700*	probably null	Het
Zcchc8	A	G	5: 123,707,403	L298P	probably damaging	Het
Zfp946	A	T	17: 22,454,716	Q150H	possibly damaging	Het

Other mutations in Gcn1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00869:Gcn1l1	APN	5	115588143	splice site	probably benign
IGL00974:Gcn1l1	APN	5	115613793	missense	possibly damaging	0.88
IGL01566:Gcn1l1	APN	5	115611058	missense	probably damaging	1.00
IGL01843:Gcn1l1	APN	5	115619700	missense	probably damaging	1.00
IGL01885:Gcn1l1	APN	5	115576115	splice site	probably null
IGL02081:Gcn1l1	APN	5	115585871	missense	probably damaging	1.00
IGL02118:Gcn1l1	APN	5	115610879	missense	probably damaging	1.00
IGL02150:Gcn1l1	APN	5	115609868	missense	probably damaging	1.00
IGL02190:Gcn1l1	APN	5	115614124	missense	probably damaging	1.00
IGL02219:Gcn1l1	APN	5	115613767	missense	possibly damaging	0.68
IGL02507:Gcn1l1	APN	5	115585881	missense	probably benign	0.11
IGL02644:Gcn1l1	APN	5	115575191	missense	probably benign
IGL02678:Gcn1l1	APN	5	115613755	missense	probably damaging	0.99
IGL02748:Gcn1l1	APN	5	115610800	splice site	probably null
IGL02755:Gcn1l1	APN	5	115604006	splice site	probably null
IGL02896:Gcn1l1	APN	5	115619648	splice site	probably benign
cusp	UTSW	5	115611060	missense	probably damaging	1.00
farthing	UTSW	5	115576108	splice site	probably benign
IGL03147:Gcn1l1	UTSW	5	115610858	missense	possibly damaging	0.78
R0362:Gcn1l1	UTSW	5	115576108	splice site	probably benign
R0540:Gcn1l1	UTSW	5	115588956	missense	probably benign	0.00
R0569:Gcn1l1	UTSW	5	115595059	missense	probably benign	0.00
R0570:Gcn1l1	UTSW	5	115592421	missense	probably damaging	1.00
R0584:Gcn1l1	UTSW	5	115595015	missense	probably damaging	1.00
R0630:Gcn1l1	UTSW	5	115581089	missense	probably benign	0.06
R0656:Gcn1l1	UTSW	5	115589303	missense	probably benign	0.27
R0801:Gcn1l1	UTSW	5	115591006	missense	probably benign	0.12
R0890:Gcn1l1	UTSW	5	115579793	missense	possibly damaging	0.77
R1400:Gcn1l1	UTSW	5	115614161	missense	probably damaging	1.00
R1485:Gcn1l1	UTSW	5	115574617	missense	probably benign
R1574:Gcn1l1	UTSW	5	115615552	missense	probably benign
R1574:Gcn1l1	UTSW	5	115615552	missense	probably benign
R1673:Gcn1l1	UTSW	5	115582297	missense	probably benign
R1894:Gcn1l1	UTSW	5	115589115	missense	probably damaging	1.00
R2114:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2116:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2117:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2152:Gcn1l1	UTSW	5	115609829	missense	probably benign	0.07
R2162:Gcn1l1	UTSW	5	115592132	missense	probably benign	0.18
R2218:Gcn1l1	UTSW	5	115619661	missense	probably benign	0.04
R2278:Gcn1l1	UTSW	5	115611175	missense	probably damaging	1.00
R2280:Gcn1l1	UTSW	5	115612730	missense	probably damaging	1.00
R3719:Gcn1l1	UTSW	5	115579817	missense	probably benign	0.03
R3729:Gcn1l1	UTSW	5	115583394	splice site	probably benign
R3833:Gcn1l1	UTSW	5	115592132	missense	probably benign	0.18
R3932:Gcn1l1	UTSW	5	115587834	missense	probably benign	0.11
R4067:Gcn1l1	UTSW	5	115599088	missense	probably damaging	1.00
R4152:Gcn1l1	UTSW	5	115613354	critical splice acceptor site	probably null
R4179:Gcn1l1	UTSW	5	115588050	missense	probably benign	0.00
R4292:Gcn1l1	UTSW	5	115576148	missense	possibly damaging	0.49
R4350:Gcn1l1	UTSW	5	115603330	missense	probably damaging	1.00
R4493:Gcn1l1	UTSW	5	115594144	missense	probably benign
R4672:Gcn1l1	UTSW	5	115606520	missense	probably damaging	1.00
R4749:Gcn1l1	UTSW	5	115614402	missense	probably benign
R4753:Gcn1l1	UTSW	5	115616478	missense	probably benign
R4826:Gcn1l1	UTSW	5	115593693	missense	probably benign
R4873:Gcn1l1	UTSW	5	115576170	missense	possibly damaging	0.92
R4875:Gcn1l1	UTSW	5	115576170	missense	possibly damaging	0.92
R4932:Gcn1l1	UTSW	5	115592144	missense	probably benign	0.00
R4992:Gcn1l1	UTSW	5	115599166	missense	probably benign	0.29
R5049:Gcn1l1	UTSW	5	115606671	missense	probably damaging	1.00
R5211:Gcn1l1	UTSW	5	115619312	missense	probably benign	0.04
R5226:Gcn1l1	UTSW	5	115588067	missense	probably benign	0.01
R5338:Gcn1l1	UTSW	5	115583403	missense	probably benign	0.00
R5914:Gcn1l1	UTSW	5	115610135	synonymous	silent
R5932:Gcn1l1	UTSW	5	115592376	missense	possibly damaging	0.77
R6422:Gcn1l1	UTSW	5	115609544	missense	probably damaging	1.00
R6435:Gcn1l1	UTSW	5	115611022	critical splice acceptor site	probably null
R6607:Gcn1l1	UTSW	5	115609478	missense	probably damaging	0.98
R6724:Gcn1l1	UTSW	5	115609158	splice site	probably null
R6861:Gcn1l1	UTSW	5	115611049	missense	probably benign
R6875:Gcn1l1	UTSW	5	115588110	missense	probably damaging	1.00
R6910:Gcn1l1	UTSW	5	115606538	missense	probably benign	0.42
R6975:Gcn1l1	UTSW	5	115613459	missense	probably damaging	1.00
R7027:Gcn1l1	UTSW	5	115616546	critical splice donor site	probably null
R7038:Gcn1l1	UTSW	5	115611144	missense	probably damaging	1.00
R7171:Gcn1l1	UTSW	5	115590293	missense	probably benign	0.02
R7276:Gcn1l1	UTSW	5	115611060	missense	probably damaging	1.00
R7456:Gcn1l1	UTSW	5	115604946	nonsense	probably null
R7473:Gcn1l1	UTSW	5	115581804	missense	probably benign	0.09
R7517:Gcn1l1	UTSW	5	115619696	missense	probably benign	0.01
R7714:Gcn1l1	UTSW	5	115595300	missense	probably damaging	0.97
R7752:Gcn1l1	UTSW	5	115615568	missense	probably damaging	1.00
R7812:Gcn1l1	UTSW	5	115593692	missense	possibly damaging	0.91
R7922:Gcn1l1	UTSW	5	115614468	missense	probably benign
R8070:Gcn1l1	UTSW	5	115588998	missense	probably benign	0.09
R8218:Gcn1l1	UTSW	5	115581529	missense	probably benign	0.00
R8329:Gcn1l1	UTSW	5	115609862	missense	probably damaging	0.99
R8413:Gcn1l1	UTSW	5	115579639	missense	probably benign	0.00
R8795:Gcn1l1	UTSW	5	115614395	missense	probably benign	0.02
R8802:Gcn1l1	UTSW	5	115609883	missense	probably damaging	1.00
R8899:Gcn1l1	UTSW	5	115579161	missense	probably benign	0.04
R8946:Gcn1l1	UTSW	5	115595345	missense	probably benign	0.02
R8963:Gcn1l1	UTSW	5	115589094	missense	probably benign	0.25
R9006:Gcn1l1	UTSW	5	115581507	missense	probably benign	0.22
R9163:Gcn1l1	UTSW	5	115604885	missense	probably benign
R9177:Gcn1l1	UTSW	5	115581808	missense	probably benign	0.35
R9187:Gcn1l1	UTSW	5	115614118	missense	probably damaging	1.00
R9411:Gcn1l1	UTSW	5	115595039	missense	possibly damaging	0.87
R9541:Gcn1l1	UTSW	5	115616357	missense	probably benign	0.00
R9574:Gcn1l1	UTSW	5	115575282	missense	possibly damaging	0.89
R9630:Gcn1l1	UTSW	5	115603290	missense	probably damaging	0.99
R9651:Gcn1l1	UTSW	5	115609606	critical splice donor site	probably null
R9761:Gcn1l1	UTSW	5	115591005	missense	probably benign	0.05
R9765:Gcn1l1	UTSW	5	115597072	nonsense	probably null
Z1177:Gcn1l1	UTSW	5	115614149	missense	probably damaging	0.99
Z1191:Gcn1l1	UTSW	5	115575293	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- AACCAGAAGGGCAGCTACTG -3'
(R):5'- CAGAATGTGACGCTGAGCAG -3'

Sequencing Primer
(F):5'- ACTGCCTCCTCATTTTTCTTTTGATG -3'
(R):5'- TGACGCTGAGCAGAAGCAAATG -3'

Posted On

2014-10-15