Incidental Mutation 'R2216:Gcn1'
ID 241146
Institutional Source Beutler Lab
Gene Symbol Gcn1
Ensembl Gene ENSMUSG00000041638
Gene Name GCN1 activator of EIF2AK4
Synonyms Gcn1l1, G431004K08Rik, GCN1L
MMRRC Submission 040218-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R2216 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 115703313-115760713 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115731720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 945 (V945E)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
AlphaFold E9PVA8
Predicted Effect probably benign
Transcript: ENSMUST00000064454
AA Change: V945E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: V945E

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 71,922,272 (GRCm39) P146T probably damaging Het
Arnt2 T A 7: 83,924,559 (GRCm39) T423S probably damaging Het
Bend5 A G 4: 111,305,787 (GRCm39) N277S probably null Het
Cd22 G T 7: 30,566,471 (GRCm39) T816N probably damaging Het
Cep126 G A 9: 8,120,679 (GRCm39) R115C probably damaging Het
Cep85 T C 4: 133,858,741 (GRCm39) H710R possibly damaging Het
Cmya5 A T 13: 93,230,003 (GRCm39) L1695H probably damaging Het
Col24a1 T C 3: 145,020,742 (GRCm39) V371A probably benign Het
Csmd1 T A 8: 17,077,355 (GRCm39) probably null Het
Cyp1a1 T A 9: 57,609,352 (GRCm39) probably null Het
Dennd1c C T 17: 57,381,492 (GRCm39) probably null Het
Dmxl1 G A 18: 50,026,990 (GRCm39) V2033I probably benign Het
Dtna A G 18: 23,702,622 (GRCm39) H51R probably damaging Het
Dysf G A 6: 84,184,227 (GRCm39) probably null Het
Gpbar1 C G 1: 74,318,053 (GRCm39) L99V probably damaging Het
Hdac9 A T 12: 34,479,516 (GRCm39) D212E probably damaging Het
Itga1 A T 13: 115,133,565 (GRCm39) D448E probably benign Het
Itga2b T A 11: 102,358,692 (GRCm39) N75I probably benign Het
Klra7 T C 6: 130,205,549 (GRCm39) E117G probably benign Het
Kmt2b G A 7: 30,273,490 (GRCm39) R2349C probably benign Het
Masp1 T C 16: 23,310,805 (GRCm39) N209S probably benign Het
Mybpc2 C T 7: 44,161,924 (GRCm39) probably null Het
Myh15 C G 16: 48,986,201 (GRCm39) S1557* probably null Het
Myo3a A C 2: 22,467,783 (GRCm39) T346P probably benign Het
Nim1k A G 13: 120,175,751 (GRCm39) Y152H probably damaging Het
Nrp2 C T 1: 62,802,077 (GRCm39) R507* probably null Het
Or13n4 T A 7: 106,423,205 (GRCm39) H176L probably damaging Het
Or5e1 C T 7: 108,354,819 (GRCm39) T252M probably damaging Het
Parp14 T C 16: 35,677,575 (GRCm39) I798V probably benign Het
Pcnx2 C T 8: 126,614,816 (GRCm39) A212T probably benign Het
Pkhd1l1 A T 15: 44,437,291 (GRCm39) H3522L probably damaging Het
Pram1 C T 17: 33,860,258 (GRCm39) A275V probably benign Het
Pramel18 T A 4: 101,767,257 (GRCm39) W169R probably damaging Het
Prkag1 A T 15: 98,713,827 (GRCm39) M1K probably null Het
Prss52 T C 14: 64,351,042 (GRCm39) S276P probably damaging Het
Ranbp17 A T 11: 33,431,125 (GRCm39) V284D probably damaging Het
Reln T C 5: 22,253,003 (GRCm39) D648G probably benign Het
Rnf112 A G 11: 61,343,105 (GRCm39) L190P probably damaging Het
Scn5a G T 9: 119,314,678 (GRCm39) P2010Q probably benign Het
Scn5a T C 9: 119,342,151 (GRCm39) Y1138C probably benign Het
Slc4a9 A G 18: 36,663,798 (GRCm39) H274R probably benign Het
Slc5a6 T G 5: 31,196,679 (GRCm39) E391D possibly damaging Het
Speer2 T C 16: 69,655,730 (GRCm39) Q32R possibly damaging Het
Tars1 A G 15: 11,389,794 (GRCm39) V372A probably benign Het
Thsd7a A T 6: 12,337,267 (GRCm39) L1250Q possibly damaging Het
Tnnt3 A G 7: 142,066,301 (GRCm39) Y222C probably benign Het
Trim40 T C 17: 37,199,875 (GRCm39) I68V probably benign Het
Trp53tg5 T C 2: 164,313,226 (GRCm39) I150V probably benign Het
Ube2u T C 4: 100,389,365 (GRCm39) V109A probably benign Het
Usp54 A T 14: 20,611,908 (GRCm39) D969E probably benign Het
Vil1 G T 1: 74,464,838 (GRCm39) R495L probably benign Het
Wfs1 T A 5: 37,124,564 (GRCm39) K700* probably null Het
Zcchc8 A G 5: 123,845,466 (GRCm39) L298P probably damaging Het
Zfp946 A T 17: 22,673,697 (GRCm39) Q150H possibly damaging Het
Other mutations in Gcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1 APN 5 115,726,202 (GRCm39) splice site probably benign
IGL00974:Gcn1 APN 5 115,751,852 (GRCm39) missense possibly damaging 0.88
IGL01566:Gcn1 APN 5 115,749,117 (GRCm39) missense probably damaging 1.00
IGL01843:Gcn1 APN 5 115,757,759 (GRCm39) missense probably damaging 1.00
IGL01885:Gcn1 APN 5 115,714,174 (GRCm39) splice site probably null
IGL02081:Gcn1 APN 5 115,723,930 (GRCm39) missense probably damaging 1.00
IGL02118:Gcn1 APN 5 115,748,938 (GRCm39) missense probably damaging 1.00
IGL02150:Gcn1 APN 5 115,747,927 (GRCm39) missense probably damaging 1.00
IGL02190:Gcn1 APN 5 115,752,183 (GRCm39) missense probably damaging 1.00
IGL02219:Gcn1 APN 5 115,751,826 (GRCm39) missense possibly damaging 0.68
IGL02507:Gcn1 APN 5 115,723,940 (GRCm39) missense probably benign 0.11
IGL02644:Gcn1 APN 5 115,713,250 (GRCm39) missense probably benign
IGL02678:Gcn1 APN 5 115,751,814 (GRCm39) missense probably damaging 0.99
IGL02748:Gcn1 APN 5 115,748,859 (GRCm39) splice site probably null
IGL02755:Gcn1 APN 5 115,742,065 (GRCm39) splice site probably null
IGL02896:Gcn1 APN 5 115,757,707 (GRCm39) splice site probably benign
cusp UTSW 5 115,749,119 (GRCm39) missense probably damaging 1.00
farthing UTSW 5 115,714,167 (GRCm39) splice site probably benign
IGL03147:Gcn1 UTSW 5 115,748,917 (GRCm39) missense possibly damaging 0.78
R0362:Gcn1 UTSW 5 115,714,167 (GRCm39) splice site probably benign
R0540:Gcn1 UTSW 5 115,727,015 (GRCm39) missense probably benign 0.00
R0569:Gcn1 UTSW 5 115,733,118 (GRCm39) missense probably benign 0.00
R0570:Gcn1 UTSW 5 115,730,480 (GRCm39) missense probably damaging 1.00
R0584:Gcn1 UTSW 5 115,733,074 (GRCm39) missense probably damaging 1.00
R0630:Gcn1 UTSW 5 115,719,148 (GRCm39) missense probably benign 0.06
R0656:Gcn1 UTSW 5 115,727,362 (GRCm39) missense probably benign 0.27
R0801:Gcn1 UTSW 5 115,729,065 (GRCm39) missense probably benign 0.12
R0890:Gcn1 UTSW 5 115,717,852 (GRCm39) missense possibly damaging 0.77
R1400:Gcn1 UTSW 5 115,752,220 (GRCm39) missense probably damaging 1.00
R1485:Gcn1 UTSW 5 115,712,676 (GRCm39) missense probably benign
R1574:Gcn1 UTSW 5 115,753,611 (GRCm39) missense probably benign
R1574:Gcn1 UTSW 5 115,753,611 (GRCm39) missense probably benign
R1673:Gcn1 UTSW 5 115,720,356 (GRCm39) missense probably benign
R1894:Gcn1 UTSW 5 115,727,174 (GRCm39) missense probably damaging 1.00
R2114:Gcn1 UTSW 5 115,736,884 (GRCm39) missense probably benign 0.35
R2116:Gcn1 UTSW 5 115,736,884 (GRCm39) missense probably benign 0.35
R2117:Gcn1 UTSW 5 115,736,884 (GRCm39) missense probably benign 0.35
R2152:Gcn1 UTSW 5 115,747,888 (GRCm39) missense probably benign 0.07
R2162:Gcn1 UTSW 5 115,730,191 (GRCm39) missense probably benign 0.18
R2218:Gcn1 UTSW 5 115,757,720 (GRCm39) missense probably benign 0.04
R2278:Gcn1 UTSW 5 115,749,234 (GRCm39) missense probably damaging 1.00
R2280:Gcn1 UTSW 5 115,750,789 (GRCm39) missense probably damaging 1.00
R3719:Gcn1 UTSW 5 115,717,876 (GRCm39) missense probably benign 0.03
R3729:Gcn1 UTSW 5 115,721,453 (GRCm39) splice site probably benign
R3833:Gcn1 UTSW 5 115,730,191 (GRCm39) missense probably benign 0.18
R3932:Gcn1 UTSW 5 115,725,893 (GRCm39) missense probably benign 0.11
R4067:Gcn1 UTSW 5 115,737,147 (GRCm39) missense probably damaging 1.00
R4152:Gcn1 UTSW 5 115,751,413 (GRCm39) critical splice acceptor site probably null
R4179:Gcn1 UTSW 5 115,726,109 (GRCm39) missense probably benign 0.00
R4292:Gcn1 UTSW 5 115,714,207 (GRCm39) missense possibly damaging 0.49
R4350:Gcn1 UTSW 5 115,741,389 (GRCm39) missense probably damaging 1.00
R4493:Gcn1 UTSW 5 115,732,203 (GRCm39) missense probably benign
R4672:Gcn1 UTSW 5 115,744,579 (GRCm39) missense probably damaging 1.00
R4749:Gcn1 UTSW 5 115,752,461 (GRCm39) missense probably benign
R4753:Gcn1 UTSW 5 115,754,537 (GRCm39) missense probably benign
R4826:Gcn1 UTSW 5 115,731,752 (GRCm39) missense probably benign
R4873:Gcn1 UTSW 5 115,714,229 (GRCm39) missense possibly damaging 0.92
R4875:Gcn1 UTSW 5 115,714,229 (GRCm39) missense possibly damaging 0.92
R4932:Gcn1 UTSW 5 115,730,203 (GRCm39) missense probably benign 0.00
R4992:Gcn1 UTSW 5 115,737,225 (GRCm39) missense probably benign 0.29
R5049:Gcn1 UTSW 5 115,744,730 (GRCm39) missense probably damaging 1.00
R5211:Gcn1 UTSW 5 115,757,371 (GRCm39) missense probably benign 0.04
R5226:Gcn1 UTSW 5 115,726,126 (GRCm39) missense probably benign 0.01
R5338:Gcn1 UTSW 5 115,721,462 (GRCm39) missense probably benign 0.00
R5914:Gcn1 UTSW 5 115,748,194 (GRCm39) synonymous silent
R5932:Gcn1 UTSW 5 115,730,435 (GRCm39) missense possibly damaging 0.77
R6422:Gcn1 UTSW 5 115,747,603 (GRCm39) missense probably damaging 1.00
R6435:Gcn1 UTSW 5 115,749,081 (GRCm39) critical splice acceptor site probably null
R6607:Gcn1 UTSW 5 115,747,537 (GRCm39) missense probably damaging 0.98
R6724:Gcn1 UTSW 5 115,747,217 (GRCm39) splice site probably null
R6861:Gcn1 UTSW 5 115,749,108 (GRCm39) missense probably benign
R6875:Gcn1 UTSW 5 115,726,169 (GRCm39) missense probably damaging 1.00
R6910:Gcn1 UTSW 5 115,744,597 (GRCm39) missense probably benign 0.42
R6975:Gcn1 UTSW 5 115,751,518 (GRCm39) missense probably damaging 1.00
R7027:Gcn1 UTSW 5 115,754,605 (GRCm39) critical splice donor site probably null
R7038:Gcn1 UTSW 5 115,749,203 (GRCm39) missense probably damaging 1.00
R7171:Gcn1 UTSW 5 115,728,352 (GRCm39) missense probably benign 0.02
R7276:Gcn1 UTSW 5 115,749,119 (GRCm39) missense probably damaging 1.00
R7456:Gcn1 UTSW 5 115,743,005 (GRCm39) nonsense probably null
R7473:Gcn1 UTSW 5 115,719,863 (GRCm39) missense probably benign 0.09
R7517:Gcn1 UTSW 5 115,757,755 (GRCm39) missense probably benign 0.01
R7714:Gcn1 UTSW 5 115,733,359 (GRCm39) missense probably damaging 0.97
R7752:Gcn1 UTSW 5 115,753,627 (GRCm39) missense probably damaging 1.00
R7812:Gcn1 UTSW 5 115,731,751 (GRCm39) missense possibly damaging 0.91
R7922:Gcn1 UTSW 5 115,752,527 (GRCm39) missense probably benign
R8070:Gcn1 UTSW 5 115,727,057 (GRCm39) missense probably benign 0.09
R8218:Gcn1 UTSW 5 115,719,588 (GRCm39) missense probably benign 0.00
R8329:Gcn1 UTSW 5 115,747,921 (GRCm39) missense probably damaging 0.99
R8413:Gcn1 UTSW 5 115,717,698 (GRCm39) missense probably benign 0.00
R8795:Gcn1 UTSW 5 115,752,454 (GRCm39) missense probably benign 0.02
R8802:Gcn1 UTSW 5 115,747,942 (GRCm39) missense probably damaging 1.00
R8899:Gcn1 UTSW 5 115,717,220 (GRCm39) missense probably benign 0.04
R8946:Gcn1 UTSW 5 115,733,404 (GRCm39) missense probably benign 0.02
R8963:Gcn1 UTSW 5 115,727,153 (GRCm39) missense probably benign 0.25
R9006:Gcn1 UTSW 5 115,719,566 (GRCm39) missense probably benign 0.22
R9163:Gcn1 UTSW 5 115,742,944 (GRCm39) missense probably benign
R9177:Gcn1 UTSW 5 115,719,867 (GRCm39) missense probably benign 0.35
R9187:Gcn1 UTSW 5 115,752,177 (GRCm39) missense probably damaging 1.00
R9411:Gcn1 UTSW 5 115,733,098 (GRCm39) missense possibly damaging 0.87
R9541:Gcn1 UTSW 5 115,754,416 (GRCm39) missense probably benign 0.00
R9574:Gcn1 UTSW 5 115,713,341 (GRCm39) missense possibly damaging 0.89
R9630:Gcn1 UTSW 5 115,741,349 (GRCm39) missense probably damaging 0.99
R9651:Gcn1 UTSW 5 115,747,665 (GRCm39) critical splice donor site probably null
R9761:Gcn1 UTSW 5 115,729,064 (GRCm39) missense probably benign 0.05
R9765:Gcn1 UTSW 5 115,735,131 (GRCm39) nonsense probably null
Z1177:Gcn1 UTSW 5 115,752,208 (GRCm39) missense probably damaging 0.99
Z1191:Gcn1 UTSW 5 115,713,352 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AACCAGAAGGGCAGCTACTG -3'
(R):5'- CAGAATGTGACGCTGAGCAG -3'

Sequencing Primer
(F):5'- ACTGCCTCCTCATTTTTCTTTTGATG -3'
(R):5'- TGACGCTGAGCAGAAGCAAATG -3'
Posted On 2014-10-15