Mutagenetix > Incidental Mutations

Incidental Mutation 'R2216:Cd22'

241153

Institutional Source

Beutler Lab

Gene Symbol

Cd22

Ensembl Gene

ENSMUSG00000030577

Gene Name

CD22 antigen

Synonyms

Lyb-8, Lyb8

MMRRC Submission

040218-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30865402-30880342 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 30867046 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 816 (T816N)

Ref Sequence

ENSEMBL: ENSMUSP00000139871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000187989] [ENSMUST00000189718] [ENSMUST00000190617] [ENSMUST00000190646] [ENSMUST00000214289]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000019248
AA Change: T816N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: T816N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108125
AA Change: T816N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: T816N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186154
AA Change: T816N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: T816N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187989

Predicted Effect

probably damaging
Transcript: ENSMUST00000189718
AA Change: T816N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: T816N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190455

Predicted Effect

probably damaging
Transcript: ENSMUST00000190617
AA Change: T816N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: T816N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190646

SMART Domains

Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	1.1e-3	SMART
IG_like	166	245	1.6e-2	SMART
IGc2	269	337	1.1e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214289
AA Change: T628N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aipl1	G	T	11: 72,031,446	P146T	probably damaging	Het
Arnt2	T	A	7: 84,275,351	T423S	probably damaging	Het
Bend5	A	G	4: 111,448,590	N277S	probably null	Het
Cep126	G	A	9: 8,120,678	R115C	probably damaging	Het
Cep85	T	C	4: 134,131,430	H710R	possibly damaging	Het
Cmya5	A	T	13: 93,093,495	L1695H	probably damaging	Het
Col24a1	T	C	3: 145,314,981	V371A	probably benign	Het
Csmd1	T	A	8: 17,027,339		probably null	Het
Cyp1a1	T	A	9: 57,702,069		probably null	Het
Dennd1c	C	T	17: 57,074,492		probably null	Het
Dmxl1	G	A	18: 49,893,923	V2033I	probably benign	Het
Dtna	A	G	18: 23,569,565	H51R	probably damaging	Het
Dysf	G	A	6: 84,207,245		probably null	Het
Gcn1l1	T	A	5: 115,593,661	V945E	probably benign	Het
Gm12800	T	A	4: 101,910,060	W169R	probably damaging	Het
Gpbar1	C	G	1: 74,278,894	L99V	probably damaging	Het
Hdac9	A	T	12: 34,429,517	D212E	probably damaging	Het
Itga1	A	T	13: 114,997,029	D448E	probably benign	Het
Itga2b	T	A	11: 102,467,866	N75I	probably benign	Het
Klra7	T	C	6: 130,228,586	E117G	probably benign	Het
Kmt2b	G	A	7: 30,574,065	R2349C	probably benign	Het
Masp1	T	C	16: 23,492,055	N209S	probably benign	Het
Mybpc2	C	T	7: 44,512,500		probably null	Het
Myh15	C	G	16: 49,165,838	S1557*	probably null	Het
Myo3a	A	C	2: 22,577,771	T346P	probably benign	Het
Nim1k	A	G	13: 119,714,215	Y152H	probably damaging	Het
Nrp2	C	T	1: 62,762,918	R507*	probably null	Het
Olfr513	C	T	7: 108,755,612	T252M	probably damaging	Het
Olfr702	T	A	7: 106,823,998	H176L	probably damaging	Het
Parp14	T	C	16: 35,857,205	I798V	probably benign	Het
Pcnx2	C	T	8: 125,888,077	A212T	probably benign	Het
Pkhd1l1	A	T	15: 44,573,895	H3522L	probably damaging	Het
Pram1	C	T	17: 33,641,284	A275V	probably benign	Het
Prkag1	A	T	15: 98,815,946	M1K	probably null	Het
Prss52	T	C	14: 64,113,593	S276P	probably damaging	Het
Ranbp17	A	T	11: 33,481,125	V284D	probably damaging	Het
Reln	T	C	5: 22,048,005	D648G	probably benign	Het
Rnf112	A	G	11: 61,452,279	L190P	probably damaging	Het
Scn5a	G	T	9: 119,485,612	P2010Q	probably benign	Het
Scn5a	T	C	9: 119,513,085	Y1138C	probably benign	Het
Slc4a9	A	G	18: 36,530,745	H274R	probably benign	Het
Slc5a6	T	G	5: 31,039,335	E391D	possibly damaging	Het
Speer2	T	C	16: 69,858,842	Q32R	possibly damaging	Het
Tars	A	G	15: 11,389,708	V372A	probably benign	Het
Thsd7a	A	T	6: 12,337,268	L1250Q	possibly damaging	Het
Tnnt3	A	G	7: 142,512,564	Y222C	probably benign	Het
Trim40	T	C	17: 36,888,983	I68V	probably benign	Het
Trp53tg5	T	C	2: 164,471,306	I150V	probably benign	Het
Ube2u	T	C	4: 100,532,168	V109A	probably benign	Het
Usp54	A	T	14: 20,561,840	D969E	probably benign	Het
Vil1	G	T	1: 74,425,679	R495L	probably benign	Het
Wfs1	T	A	5: 36,967,220	K700*	probably null	Het
Zcchc8	A	G	5: 123,707,403	L298P	probably damaging	Het
Zfp946	A	T	17: 22,454,716	Q150H	possibly damaging	Het

Other mutations in Cd22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00714:Cd22	APN	7	30876147	missense	probably benign	0.01
IGL02236:Cd22	APN	7	30867468	missense	possibly damaging	0.54
IGL02321:Cd22	APN	7	30869883	missense	probably damaging	1.00
IGL02335:Cd22	APN	7	30876134	missense	probably damaging	1.00
IGL02397:Cd22	APN	7	30877625	missense	probably benign
IGL02402:Cd22	APN	7	30877530	missense	possibly damaging	0.86
IGL02538:Cd22	APN	7	30877560	missense	probably benign	0.40
IGL02736:Cd22	APN	7	30878045	splice site	probably null
crullers	UTSW	7	30869883	missense	probably damaging	1.00
gansu	UTSW	7	30870105	missense	probably damaging	1.00
lacrima	UTSW	7	30876153	missense	probably damaging	1.00
Lluvia	UTSW	7	30870487	missense	possibly damaging	0.48
Mist	UTSW	7	30866658	missense	probably damaging	1.00
rain	UTSW	7	30877534	missense	probably damaging	1.00
well	UTSW	7	30877787	nonsense	probably null
Yosemite	UTSW	7	30869509	critical splice donor site	probably null
FR4304:Cd22	UTSW	7	30878082	missense	possibly damaging	0.95
FR4340:Cd22	UTSW	7	30878082	missense	possibly damaging	0.95
FR4342:Cd22	UTSW	7	30878082	missense	possibly damaging	0.95
FR4589:Cd22	UTSW	7	30878082	missense	possibly damaging	0.95
LCD18:Cd22	UTSW	7	30878082	missense	possibly damaging	0.95
PIT4142001:Cd22	UTSW	7	30877799	missense	possibly damaging	0.92
R0123:Cd22	UTSW	7	30867108	splice site	probably benign
R0130:Cd22	UTSW	7	30869964	missense	possibly damaging	0.92
R0926:Cd22	UTSW	7	30869509	critical splice donor site	probably null
R1245:Cd22	UTSW	7	30869883	missense	probably damaging	1.00
R1332:Cd22	UTSW	7	30870487	missense	possibly damaging	0.48
R1457:Cd22	UTSW	7	30873170	missense	probably benign	0.07
R1716:Cd22	UTSW	7	30877678	missense	probably damaging	1.00
R1980:Cd22	UTSW	7	30873233	missense	probably damaging	1.00
R2017:Cd22	UTSW	7	30872780	missense	probably damaging	0.99
R2061:Cd22	UTSW	7	30870105	missense	probably damaging	1.00
R2061:Cd22	UTSW	7	30876156	missense	probably benign	0.03
R2075:Cd22	UTSW	7	30869698	missense	probably damaging	1.00
R3886:Cd22	UTSW	7	30870107	missense	possibly damaging	0.57
R4599:Cd22	UTSW	7	30875900	missense	probably damaging	0.98
R4701:Cd22	UTSW	7	30876153	missense	probably damaging	1.00
R4796:Cd22	UTSW	7	30872956	splice site	probably null
R5179:Cd22	UTSW	7	30875874	missense	possibly damaging	0.81
R5233:Cd22	UTSW	7	30877534	missense	probably damaging	1.00
R5456:Cd22	UTSW	7	30876039	missense	probably benign	0.02
R5511:Cd22	UTSW	7	30870071	missense	probably damaging	1.00
R5513:Cd22	UTSW	7	30867025	missense	probably damaging	0.99
R5611:Cd22	UTSW	7	30878150	unclassified	probably benign
R5656:Cd22	UTSW	7	30869773	missense	probably damaging	1.00
R5966:Cd22	UTSW	7	30866658	missense	probably damaging	1.00
R6329:Cd22	UTSW	7	30877768	missense	probably damaging	0.99
R6356:Cd22	UTSW	7	30877702	missense	probably damaging	1.00
R6455:Cd22	UTSW	7	30876153	missense	probably damaging	1.00
R6550:Cd22	UTSW	7	30877552	missense	probably benign	0.00
R6656:Cd22	UTSW	7	30877757	missense	probably benign	0.11
R6688:Cd22	UTSW	7	30872964	missense	possibly damaging	0.91
R6844:Cd22	UTSW	7	30873431	splice site	probably null
R6957:Cd22	UTSW	7	30867574	missense	possibly damaging	0.88
R7068:Cd22	UTSW	7	30878079	missense	probably benign	0.03
R7083:Cd22	UTSW	7	30868048	missense	probably damaging	0.99
R7225:Cd22	UTSW	7	30877634	missense	not run
R7732:Cd22	UTSW	7	30870057	missense	probably damaging	1.00
R8686:Cd22	UTSW	7	30870069	missense	probably benign	0.03
R8851:Cd22	UTSW	7	30877659	missense	probably benign	0.01
R8987:Cd22	UTSW	7	30877747	missense	probably damaging	1.00
R9051:Cd22	UTSW	7	30876024	missense	probably benign
R9098:Cd22	UTSW	7	30867966	missense	probably benign	0.00
R9124:Cd22	UTSW	7	30873237	missense	probably benign	0.01
X0025:Cd22	UTSW	7	30873419	splice site	probably null
Z1176:Cd22	UTSW	7	30867963	missense	probably benign	0.03
Z1176:Cd22	UTSW	7	30869530	missense	probably damaging	1.00
Z1186:Cd22	UTSW	7	30867053	missense	probably benign	0.01
Z1186:Cd22	UTSW	7	30867466	missense	probably benign
Z1186:Cd22	UTSW	7	30875867	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CAAGGCAGAGACTGTTTTAGGG -3'
(R):5'- CAGCCATTTTCATTAGCTGCTG -3'

Sequencing Primer
(F):5'- TATGCCCCAGCTGTGAAATAAG -3'
(R):5'- CTGCTCTGGTGCTGTGC -3'

Posted On

2014-10-15