Mutagenetix > Incidental Mutation

Incidental Mutation 'R2216:Mybpc2'

241154

Institutional Source

Beutler Lab

Gene Symbol

Mybpc2

Ensembl Gene

ENSMUSG00000038670

Gene Name

myosin binding protein C, fast-type

Synonyms

Fast-type C-protein

MMRRC Submission

040218-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44501699-44524656 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 44512500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165208]

AlphaFold

Q5XKE0

Predicted Effect

probably damaging
Transcript: ENSMUST00000165208
AA Change: G509S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670
AA Change: G509S

Domain	Start	End	E-Value	Type
low complexity region	2	37	N/A	INTRINSIC
IG	54	150	6.26e-5	SMART
PDB:2LHU\|A	160	236	7e-9	PDB
low complexity region	237	252	N/A	INTRINSIC
IG	258	337	5.21e-2	SMART
IG	347	430	1.2e-1	SMART
IG	440	526	2.72e-5	SMART
IG	546	631	1.68e-5	SMART
FN3	634	717	3.29e-11	SMART
FN3	732	815	1.23e-10	SMART
IG	842	925	6.07e-3	SMART
FN3	928	1010	2.08e-8	SMART
IGc2	1055	1122	6.91e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000207516

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. This family includes the fast-, slow- and cardiac-type isoforms, each of which is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The protein encoded by this locus is referred to as the fast-type isoform. Mutations in the related but distinct genes encoding the slow-type and cardiac-type isoforms have been associated with distal arthrogryposis, type 1 and hypertrophic cardiomyopathy, respectively. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aipl1	G	T	11: 72,031,446	P146T	probably damaging	Het
Arnt2	T	A	7: 84,275,351	T423S	probably damaging	Het
Bend5	A	G	4: 111,448,590	N277S	probably null	Het
Cd22	G	T	7: 30,867,046	T816N	probably damaging	Het
Cep126	G	A	9: 8,120,678	R115C	probably damaging	Het
Cep85	T	C	4: 134,131,430	H710R	possibly damaging	Het
Cmya5	A	T	13: 93,093,495	L1695H	probably damaging	Het
Col24a1	T	C	3: 145,314,981	V371A	probably benign	Het
Csmd1	T	A	8: 17,027,339		probably null	Het
Cyp1a1	T	A	9: 57,702,069		probably null	Het
Dennd1c	C	T	17: 57,074,492		probably null	Het
Dmxl1	G	A	18: 49,893,923	V2033I	probably benign	Het
Dtna	A	G	18: 23,569,565	H51R	probably damaging	Het
Dysf	G	A	6: 84,207,245		probably null	Het
Gcn1l1	T	A	5: 115,593,661	V945E	probably benign	Het
Gm12800	T	A	4: 101,910,060	W169R	probably damaging	Het
Gpbar1	C	G	1: 74,278,894	L99V	probably damaging	Het
Hdac9	A	T	12: 34,429,517	D212E	probably damaging	Het
Itga1	A	T	13: 114,997,029	D448E	probably benign	Het
Itga2b	T	A	11: 102,467,866	N75I	probably benign	Het
Klra7	T	C	6: 130,228,586	E117G	probably benign	Het
Kmt2b	G	A	7: 30,574,065	R2349C	probably benign	Het
Masp1	T	C	16: 23,492,055	N209S	probably benign	Het
Myh15	C	G	16: 49,165,838	S1557*	probably null	Het
Myo3a	A	C	2: 22,577,771	T346P	probably benign	Het
Nim1k	A	G	13: 119,714,215	Y152H	probably damaging	Het
Nrp2	C	T	1: 62,762,918	R507*	probably null	Het
Olfr513	C	T	7: 108,755,612	T252M	probably damaging	Het
Olfr702	T	A	7: 106,823,998	H176L	probably damaging	Het
Parp14	T	C	16: 35,857,205	I798V	probably benign	Het
Pcnx2	C	T	8: 125,888,077	A212T	probably benign	Het
Pkhd1l1	A	T	15: 44,573,895	H3522L	probably damaging	Het
Pram1	C	T	17: 33,641,284	A275V	probably benign	Het
Prkag1	A	T	15: 98,815,946	M1K	probably null	Het
Prss52	T	C	14: 64,113,593	S276P	probably damaging	Het
Ranbp17	A	T	11: 33,481,125	V284D	probably damaging	Het
Reln	T	C	5: 22,048,005	D648G	probably benign	Het
Rnf112	A	G	11: 61,452,279	L190P	probably damaging	Het
Scn5a	G	T	9: 119,485,612	P2010Q	probably benign	Het
Scn5a	T	C	9: 119,513,085	Y1138C	probably benign	Het
Slc4a9	A	G	18: 36,530,745	H274R	probably benign	Het
Slc5a6	T	G	5: 31,039,335	E391D	possibly damaging	Het
Speer2	T	C	16: 69,858,842	Q32R	possibly damaging	Het
Tars	A	G	15: 11,389,708	V372A	probably benign	Het
Thsd7a	A	T	6: 12,337,268	L1250Q	possibly damaging	Het
Tnnt3	A	G	7: 142,512,564	Y222C	probably benign	Het
Trim40	T	C	17: 36,888,983	I68V	probably benign	Het
Trp53tg5	T	C	2: 164,471,306	I150V	probably benign	Het
Ube2u	T	C	4: 100,532,168	V109A	probably benign	Het
Usp54	A	T	14: 20,561,840	D969E	probably benign	Het
Vil1	G	T	1: 74,425,679	R495L	probably benign	Het
Wfs1	T	A	5: 36,967,220	K700*	probably null	Het
Zcchc8	A	G	5: 123,707,403	L298P	probably damaging	Het
Zfp946	A	T	17: 22,454,716	Q150H	possibly damaging	Het

Other mutations in Mybpc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Mybpc2	APN	7	44505405	unclassified	probably benign
IGL00586:Mybpc2	APN	7	44505382	missense	probably damaging	0.96
IGL00976:Mybpc2	APN	7	44522317	splice site	probably null
IGL01099:Mybpc2	APN	7	44516167	missense	probably damaging	0.99
IGL01348:Mybpc2	APN	7	44515928	missense	probably benign
IGL01625:Mybpc2	APN	7	44516913	missense	possibly damaging	0.65
IGL01733:Mybpc2	APN	7	44506198	missense	probably benign	0.03
IGL01946:Mybpc2	APN	7	44509898	unclassified	probably benign
IGL02078:Mybpc2	APN	7	44503780	missense	probably damaging	1.00
IGL02314:Mybpc2	APN	7	44522388	missense	possibly damaging	0.82
IGL02341:Mybpc2	APN	7	44514930	missense	probably benign	0.00
IGL02904:Mybpc2	APN	7	44522341	missense	probably benign	0.05
IGL03034:Mybpc2	APN	7	44511897	missense	possibly damaging	0.87
IGL03296:Mybpc2	APN	7	44506884	missense	probably damaging	1.00
R0094:Mybpc2	UTSW	7	44516904	missense	probably damaging	1.00
R0329:Mybpc2	UTSW	7	44509029	missense	possibly damaging	0.94
R0330:Mybpc2	UTSW	7	44509029	missense	possibly damaging	0.94
R0336:Mybpc2	UTSW	7	44505616	missense	probably damaging	1.00
R0503:Mybpc2	UTSW	7	44512570	unclassified	probably benign
R0821:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0822:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0823:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0854:Mybpc2	UTSW	7	44517002	missense	probably benign	0.06
R0938:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0939:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0940:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0941:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R1166:Mybpc2	UTSW	7	44505025	missense	possibly damaging	0.84
R1219:Mybpc2	UTSW	7	44516034	splice site	probably null
R1559:Mybpc2	UTSW	7	44513687	missense	probably benign	0.01
R1732:Mybpc2	UTSW	7	44513675	missense	probably benign
R1802:Mybpc2	UTSW	7	44512470	missense	possibly damaging	0.81
R2157:Mybpc2	UTSW	7	44509845	missense	possibly damaging	0.93
R2406:Mybpc2	UTSW	7	44521725	missense	possibly damaging	0.62
R2411:Mybpc2	UTSW	7	44506238	missense	probably damaging	1.00
R3079:Mybpc2	UTSW	7	44506081	missense	probably damaging	1.00
R4663:Mybpc2	UTSW	7	44505642	missense	probably damaging	0.99
R4736:Mybpc2	UTSW	7	44512547	missense	probably damaging	1.00
R5316:Mybpc2	UTSW	7	44520382	nonsense	probably null
R5426:Mybpc2	UTSW	7	44509829	missense	probably benign	0.01
R5498:Mybpc2	UTSW	7	44516265	missense	probably damaging	1.00
R5539:Mybpc2	UTSW	7	44514893	missense	probably benign	0.17
R5644:Mybpc2	UTSW	7	44507053	missense	probably benign	0.13
R5909:Mybpc2	UTSW	7	44507091	missense	probably damaging	1.00
R6435:Mybpc2	UTSW	7	44506057	missense	possibly damaging	0.73
R6662:Mybpc2	UTSW	7	44506166	missense	probably benign
R6901:Mybpc2	UTSW	7	44505355	missense	probably damaging	0.99
R7188:Mybpc2	UTSW	7	44506193	missense	probably benign	0.06
R7389:Mybpc2	UTSW	7	44505604	missense	probably benign	0.11
R7405:Mybpc2	UTSW	7	44507194	missense	probably damaging	1.00
R7553:Mybpc2	UTSW	7	44506147	missense	possibly damaging	0.51
R7597:Mybpc2	UTSW	7	44509799	missense	probably damaging	1.00
R7772:Mybpc2	UTSW	7	44515924	critical splice donor site	probably null
R7824:Mybpc2	UTSW	7	44504860	splice site	probably null
R8003:Mybpc2	UTSW	7	44509064	missense	probably damaging	0.99
R8179:Mybpc2	UTSW	7	44509830	missense	probably benign	0.01
R8187:Mybpc2	UTSW	7	44512470	missense	possibly damaging	0.81
R8413:Mybpc2	UTSW	7	44508305	missense	probably damaging	1.00
R8729:Mybpc2	UTSW	7	44506187	missense	probably damaging	1.00
R8830:Mybpc2	UTSW	7	44512541	missense	probably damaging	1.00
R9377:Mybpc2	UTSW	7	44509575	missense	probably benign	0.22
R9441:Mybpc2	UTSW	7	44516906	missense	probably null	0.96
X0052:Mybpc2	UTSW	7	44507142	missense	probably benign	0.23
X0065:Mybpc2	UTSW	7	44505385	missense	probably benign	0.01
Z1088:Mybpc2	UTSW	7	44516503	missense	possibly damaging	0.47
Z1176:Mybpc2	UTSW	7	44521696	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTCCCCATGAATATGCATCAG -3'
(R):5'- TGACACATGAGGTAGACCCTG -3'

Sequencing Primer
(F):5'- ATCTGACGCTATCCATGGGC -3'
(R):5'- TAGACCCTGGCCTCACATG -3'

Posted On

2014-10-15