Mutagenetix > Incidental Mutation

Incidental Mutation 'R2216:Arnt2'

241155

Institutional Source

Beutler Lab

Gene Symbol

Arnt2

Ensembl Gene

ENSMUSG00000015709

Gene Name

aryl hydrocarbon receptor nuclear translocator 2

Synonyms

bHLHe1

MMRRC Submission

040218-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84246278-84410176 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84275351 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 423 (T423S)

Ref Sequence

ENSEMBL: ENSMUSP00000147129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000208232] [ENSMUST00000209133]

AlphaFold

Q61324

Predicted Effect

probably damaging
Transcript: ENSMUST00000085077
AA Change: T434S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: T434S

Domain	Start	End	E-Value	Type
HLH	69	122	1.42e-14	SMART
PAS	137	204	1.28e-8	SMART
low complexity region	225	236	N/A	INTRINSIC
PAS	325	391	4.15e-8	SMART
PAC	398	441	7.93e-5	SMART
low complexity region	502	526	N/A	INTRINSIC
low complexity region	597	626	N/A	INTRINSIC
low complexity region	653	675	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207459

Predicted Effect

probably benign
Transcript: ENSMUST00000208129

Predicted Effect

probably damaging
Transcript: ENSMUST00000208232
AA Change: T423S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208936

Predicted Effect

probably damaging
Transcript: ENSMUST00000209133
AA Change: T423S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aipl1	G	T	11: 72,031,446	P146T	probably damaging	Het
Bend5	A	G	4: 111,448,590	N277S	probably null	Het
Cd22	G	T	7: 30,867,046	T816N	probably damaging	Het
Cep126	G	A	9: 8,120,678	R115C	probably damaging	Het
Cep85	T	C	4: 134,131,430	H710R	possibly damaging	Het
Cmya5	A	T	13: 93,093,495	L1695H	probably damaging	Het
Col24a1	T	C	3: 145,314,981	V371A	probably benign	Het
Csmd1	T	A	8: 17,027,339		probably null	Het
Cyp1a1	T	A	9: 57,702,069		probably null	Het
Dennd1c	C	T	17: 57,074,492		probably null	Het
Dmxl1	G	A	18: 49,893,923	V2033I	probably benign	Het
Dtna	A	G	18: 23,569,565	H51R	probably damaging	Het
Dysf	G	A	6: 84,207,245		probably null	Het
Gcn1l1	T	A	5: 115,593,661	V945E	probably benign	Het
Gm12800	T	A	4: 101,910,060	W169R	probably damaging	Het
Gpbar1	C	G	1: 74,278,894	L99V	probably damaging	Het
Hdac9	A	T	12: 34,429,517	D212E	probably damaging	Het
Itga1	A	T	13: 114,997,029	D448E	probably benign	Het
Itga2b	T	A	11: 102,467,866	N75I	probably benign	Het
Klra7	T	C	6: 130,228,586	E117G	probably benign	Het
Kmt2b	G	A	7: 30,574,065	R2349C	probably benign	Het
Masp1	T	C	16: 23,492,055	N209S	probably benign	Het
Mybpc2	C	T	7: 44,512,500		probably null	Het
Myh15	C	G	16: 49,165,838	S1557*	probably null	Het
Myo3a	A	C	2: 22,577,771	T346P	probably benign	Het
Nim1k	A	G	13: 119,714,215	Y152H	probably damaging	Het
Nrp2	C	T	1: 62,762,918	R507*	probably null	Het
Olfr513	C	T	7: 108,755,612	T252M	probably damaging	Het
Olfr702	T	A	7: 106,823,998	H176L	probably damaging	Het
Parp14	T	C	16: 35,857,205	I798V	probably benign	Het
Pcnx2	C	T	8: 125,888,077	A212T	probably benign	Het
Pkhd1l1	A	T	15: 44,573,895	H3522L	probably damaging	Het
Pram1	C	T	17: 33,641,284	A275V	probably benign	Het
Prkag1	A	T	15: 98,815,946	M1K	probably null	Het
Prss52	T	C	14: 64,113,593	S276P	probably damaging	Het
Ranbp17	A	T	11: 33,481,125	V284D	probably damaging	Het
Reln	T	C	5: 22,048,005	D648G	probably benign	Het
Rnf112	A	G	11: 61,452,279	L190P	probably damaging	Het
Scn5a	G	T	9: 119,485,612	P2010Q	probably benign	Het
Scn5a	T	C	9: 119,513,085	Y1138C	probably benign	Het
Slc4a9	A	G	18: 36,530,745	H274R	probably benign	Het
Slc5a6	T	G	5: 31,039,335	E391D	possibly damaging	Het
Speer2	T	C	16: 69,858,842	Q32R	possibly damaging	Het
Tars	A	G	15: 11,389,708	V372A	probably benign	Het
Thsd7a	A	T	6: 12,337,268	L1250Q	possibly damaging	Het
Tnnt3	A	G	7: 142,512,564	Y222C	probably benign	Het
Trim40	T	C	17: 36,888,983	I68V	probably benign	Het
Trp53tg5	T	C	2: 164,471,306	I150V	probably benign	Het
Ube2u	T	C	4: 100,532,168	V109A	probably benign	Het
Usp54	A	T	14: 20,561,840	D969E	probably benign	Het
Vil1	G	T	1: 74,425,679	R495L	probably benign	Het
Wfs1	T	A	5: 36,967,220	K700*	probably null	Het
Zcchc8	A	G	5: 123,707,403	L298P	probably damaging	Het
Zfp946	A	T	17: 22,454,716	Q150H	possibly damaging	Het

Other mutations in Arnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Arnt2	APN	7	84285829	missense	probably benign	0.01
IGL01525:Arnt2	APN	7	84275408	missense	possibly damaging	0.70
IGL02331:Arnt2	APN	7	84265624	missense	probably damaging	1.00
IGL02483:Arnt2	APN	7	84251397	missense	probably damaging	1.00
IGL02863:Arnt2	APN	7	84267937	missense	probably damaging	1.00
IGL03207:Arnt2	APN	7	84343834	missense	possibly damaging	0.93
Arnold2	UTSW	7	84347530	missense	probably damaging	1.00
porker	UTSW	7	84343942	missense	probably damaging	1.00
R0024:Arnt2	UTSW	7	84284126	missense	probably benign	0.03
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0060:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0113:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0114:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0201:Arnt2	UTSW	7	84361659	nonsense	probably null
R0514:Arnt2	UTSW	7	84304859	missense	probably benign	0.00
R0863:Arnt2	UTSW	7	84265584	missense	probably damaging	1.00
R1800:Arnt2	UTSW	7	84275375	missense	probably damaging	1.00
R1944:Arnt2	UTSW	7	84343751	missense	probably benign	0.01
R1964:Arnt2	UTSW	7	84343789	missense	possibly damaging	0.55
R2061:Arnt2	UTSW	7	84343870	missense	probably damaging	1.00
R3107:Arnt2	UTSW	7	84262444	missense	possibly damaging	0.95
R3410:Arnt2	UTSW	7	84275447	missense	probably damaging	1.00
R3739:Arnt2	UTSW	7	84343801	missense	probably null	1.00
R4258:Arnt2	UTSW	7	84310955	missense	probably damaging	0.98
R4486:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4489:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4668:Arnt2	UTSW	7	84275386	missense	probably damaging	1.00
R5685:Arnt2	UTSW	7	84263265	missense	probably benign	0.00
R5876:Arnt2	UTSW	7	84347512	missense	probably damaging	1.00
R5923:Arnt2	UTSW	7	84262533	missense	probably benign	0.32
R5926:Arnt2	UTSW	7	84343946	missense	probably damaging	0.99
R6122:Arnt2	UTSW	7	84361565	missense	probably damaging	1.00
R7021:Arnt2	UTSW	7	84343942	missense	probably damaging	1.00
R7895:Arnt2	UTSW	7	84305198	missense	probably benign
R7898:Arnt2	UTSW	7	84268947	splice site	probably null
R8386:Arnt2	UTSW	7	84347539	missense	probably damaging	1.00
R9038:Arnt2	UTSW	7	84304851	missense	probably benign
R9258:Arnt2	UTSW	7	84361590	missense	probably damaging	1.00
R9346:Arnt2	UTSW	7	84282113	missense	probably benign	0.04
R9452:Arnt2	UTSW	7	84284126	missense	probably benign	0.03
R9636:Arnt2	UTSW	7	84343834	missense	probably benign	0.44
R9780:Arnt2	UTSW	7	84305218	missense	probably benign	0.02
X0066:Arnt2	UTSW	7	84285784	missense	possibly damaging	0.93
Z1176:Arnt2	UTSW	7	84263196	missense	probably benign	0.41
Z1177:Arnt2	UTSW	7	84263207	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- ATGGAAGGGATGCACACCAC -3'
(R):5'- GTATGAGCCTAGCTGCTACC -3'

Sequencing Primer
(F):5'- CAGTAAAGGAAACCCAGAGTCTC -3'
(R):5'- AGCAGCACCCCATTCTGTG -3'

Posted On

2014-10-15