Incidental Mutation 'R2216:Olfr702'
ID241156
Institutional Source Beutler Lab
Gene Symbol Olfr702
Ensembl Gene ENSMUSG00000056863
Gene Nameolfactory receptor 702
SynonymsMOR260-4, GA_x6K02T2PBJ9-9202245-9201289
MMRRC Submission 040218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R2216 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106823489-106833893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106823998 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 176 (H176L)
Ref Sequence ENSEMBL: ENSMUSP00000151862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075414] [ENSMUST00000080899] [ENSMUST00000166880] [ENSMUST00000208864] [ENSMUST00000208895] [ENSMUST00000217739] [ENSMUST00000219803]
Predicted Effect probably benign
Transcript: ENSMUST00000075414
SMART Domains Protein: ENSMUSP00000074868
Gene: ENSMUSG00000036744

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-46 PFAM
Pfam:7tm_1 41 290 2.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080899
AA Change: H176L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079704
Gene: ENSMUSG00000056863
AA Change: H176L

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 300 2.9e-8 PFAM
Pfam:7tm_1 41 290 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166880
SMART Domains Protein: ENSMUSP00000130958
Gene: ENSMUSG00000036744

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.8e-31 PFAM
Pfam:7tm_4 139 283 1.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208864
Predicted Effect probably benign
Transcript: ENSMUST00000208895
Predicted Effect probably benign
Transcript: ENSMUST00000217739
Predicted Effect probably damaging
Transcript: ENSMUST00000219803
AA Change: H176L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 72,031,446 P146T probably damaging Het
Arnt2 T A 7: 84,275,351 T423S probably damaging Het
Bend5 A G 4: 111,448,590 N277S probably null Het
Cd22 G T 7: 30,867,046 T816N probably damaging Het
Cep126 G A 9: 8,120,678 R115C probably damaging Het
Cep85 T C 4: 134,131,430 H710R possibly damaging Het
Cmya5 A T 13: 93,093,495 L1695H probably damaging Het
Col24a1 T C 3: 145,314,981 V371A probably benign Het
Csmd1 T A 8: 17,027,339 probably null Het
Cyp1a1 T A 9: 57,702,069 probably null Het
Dennd1c C T 17: 57,074,492 probably null Het
Dmxl1 G A 18: 49,893,923 V2033I probably benign Het
Dtna A G 18: 23,569,565 H51R probably damaging Het
Dysf G A 6: 84,207,245 probably null Het
Gcn1l1 T A 5: 115,593,661 V945E probably benign Het
Gm12800 T A 4: 101,910,060 W169R probably damaging Het
Gpbar1 C G 1: 74,278,894 L99V probably damaging Het
Hdac9 A T 12: 34,429,517 D212E probably damaging Het
Itga1 A T 13: 114,997,029 D448E probably benign Het
Itga2b T A 11: 102,467,866 N75I probably benign Het
Klra7 T C 6: 130,228,586 E117G probably benign Het
Kmt2b G A 7: 30,574,065 R2349C probably benign Het
Masp1 T C 16: 23,492,055 N209S probably benign Het
Mybpc2 C T 7: 44,512,500 probably null Het
Myh15 C G 16: 49,165,838 S1557* probably null Het
Myo3a A C 2: 22,577,771 T346P probably benign Het
Nim1k A G 13: 119,714,215 Y152H probably damaging Het
Nrp2 C T 1: 62,762,918 R507* probably null Het
Olfr513 C T 7: 108,755,612 T252M probably damaging Het
Parp14 T C 16: 35,857,205 I798V probably benign Het
Pcnx2 C T 8: 125,888,077 A212T probably benign Het
Pkhd1l1 A T 15: 44,573,895 H3522L probably damaging Het
Pram1 C T 17: 33,641,284 A275V probably benign Het
Prkag1 A T 15: 98,815,946 M1K probably null Het
Prss52 T C 14: 64,113,593 S276P probably damaging Het
Ranbp17 A T 11: 33,481,125 V284D probably damaging Het
Reln T C 5: 22,048,005 D648G probably benign Het
Rnf112 A G 11: 61,452,279 L190P probably damaging Het
Scn5a G T 9: 119,485,612 P2010Q probably benign Het
Scn5a T C 9: 119,513,085 Y1138C probably benign Het
Slc4a9 A G 18: 36,530,745 H274R probably benign Het
Slc5a6 T G 5: 31,039,335 E391D possibly damaging Het
Speer2 T C 16: 69,858,842 Q32R possibly damaging Het
Tars A G 15: 11,389,708 V372A probably benign Het
Thsd7a A T 6: 12,337,268 L1250Q possibly damaging Het
Tnnt3 A G 7: 142,512,564 Y222C probably benign Het
Trim40 T C 17: 36,888,983 I68V probably benign Het
Trp53tg5 T C 2: 164,471,306 I150V probably benign Het
Ube2u T C 4: 100,532,168 V109A probably benign Het
Usp54 A T 14: 20,561,840 D969E probably benign Het
Vil1 G T 1: 74,425,679 R495L probably benign Het
Wfs1 T A 5: 36,967,220 K700* probably null Het
Zcchc8 A G 5: 123,707,403 L298P probably damaging Het
Zfp946 A T 17: 22,454,716 Q150H possibly damaging Het
Other mutations in Olfr702
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Olfr702 APN 7 106824029 missense probably benign 0.01
IGL02120:Olfr702 APN 7 106823698 missense possibly damaging 0.94
R0025:Olfr702 UTSW 7 106823756 missense possibly damaging 0.74
R1213:Olfr702 UTSW 7 106824197 missense possibly damaging 0.48
R1830:Olfr702 UTSW 7 106824110 missense probably benign 0.00
R2571:Olfr702 UTSW 7 106823726 missense probably benign 0.09
R2876:Olfr702 UTSW 7 106824457 missense probably benign 0.07
R2920:Olfr702 UTSW 7 106824364 missense probably benign 0.11
R4082:Olfr702 UTSW 7 106824038 missense possibly damaging 0.78
R4130:Olfr702 UTSW 7 106823585 missense probably benign 0.01
R4750:Olfr702 UTSW 7 106824307 missense probably damaging 0.98
R5007:Olfr702 UTSW 7 106824157 missense probably damaging 1.00
R5117:Olfr702 UTSW 7 106823662 missense probably damaging 0.99
R5908:Olfr702 UTSW 7 106824197 missense probably benign 0.09
R6824:Olfr702 UTSW 7 106824457 missense probably benign 0.00
R7193:Olfr702 UTSW 7 106824591 start gained probably benign
R7254:Olfr702 UTSW 7 106823570 makesense probably null
R7827:Olfr702 UTSW 7 106823725 missense probably benign 0.01
R8309:Olfr702 UTSW 7 106824413 missense probably benign 0.00
R8410:Olfr702 UTSW 7 106824538 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGACCCATAGTAGAGGAC -3'
(R):5'- ATGACCGGTATGTTGCTGTC -3'

Sequencing Primer
(F):5'- GGTTGAAAAGACCTTGAGCCTTCC -3'
(R):5'- GGGCATTTGCATGTTCAG -3'
Posted On2014-10-15