Incidental Mutation 'R2216:Cyp1a1'
ID241162
Institutional Source Beutler Lab
Gene Symbol Cyp1a1
Ensembl Gene ENSMUSG00000032315
Gene Namecytochrome P450, family 1, subfamily a, polypeptide 1
SynonymsP450-1, cytochrome P450 subfamily I, polypeptide 1
MMRRC Submission 040218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R2216 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57687928-57703824 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 57702069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034865] [ENSMUST00000216433]
Predicted Effect probably null
Transcript: ENSMUST00000034865
SMART Domains Protein: ENSMUSP00000034865
Gene: ENSMUSG00000032315

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 44 509 2.3e-111 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216433
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 72,031,446 P146T probably damaging Het
Arnt2 T A 7: 84,275,351 T423S probably damaging Het
Bend5 A G 4: 111,448,590 N277S probably null Het
Cd22 G T 7: 30,867,046 T816N probably damaging Het
Cep126 G A 9: 8,120,678 R115C probably damaging Het
Cep85 T C 4: 134,131,430 H710R possibly damaging Het
Cmya5 A T 13: 93,093,495 L1695H probably damaging Het
Col24a1 T C 3: 145,314,981 V371A probably benign Het
Csmd1 T A 8: 17,027,339 probably null Het
Dennd1c C T 17: 57,074,492 probably null Het
Dmxl1 G A 18: 49,893,923 V2033I probably benign Het
Dtna A G 18: 23,569,565 H51R probably damaging Het
Dysf G A 6: 84,207,245 probably null Het
Gcn1l1 T A 5: 115,593,661 V945E probably benign Het
Gm12800 T A 4: 101,910,060 W169R probably damaging Het
Gpbar1 C G 1: 74,278,894 L99V probably damaging Het
Hdac9 A T 12: 34,429,517 D212E probably damaging Het
Itga1 A T 13: 114,997,029 D448E probably benign Het
Itga2b T A 11: 102,467,866 N75I probably benign Het
Klra7 T C 6: 130,228,586 E117G probably benign Het
Kmt2b G A 7: 30,574,065 R2349C probably benign Het
Masp1 T C 16: 23,492,055 N209S probably benign Het
Mybpc2 C T 7: 44,512,500 probably null Het
Myh15 C G 16: 49,165,838 S1557* probably null Het
Myo3a A C 2: 22,577,771 T346P probably benign Het
Nim1k A G 13: 119,714,215 Y152H probably damaging Het
Nrp2 C T 1: 62,762,918 R507* probably null Het
Olfr513 C T 7: 108,755,612 T252M probably damaging Het
Olfr702 T A 7: 106,823,998 H176L probably damaging Het
Parp14 T C 16: 35,857,205 I798V probably benign Het
Pcnx2 C T 8: 125,888,077 A212T probably benign Het
Pkhd1l1 A T 15: 44,573,895 H3522L probably damaging Het
Pram1 C T 17: 33,641,284 A275V probably benign Het
Prkag1 A T 15: 98,815,946 M1K probably null Het
Prss52 T C 14: 64,113,593 S276P probably damaging Het
Ranbp17 A T 11: 33,481,125 V284D probably damaging Het
Reln T C 5: 22,048,005 D648G probably benign Het
Rnf112 A G 11: 61,452,279 L190P probably damaging Het
Scn5a G T 9: 119,485,612 P2010Q probably benign Het
Scn5a T C 9: 119,513,085 Y1138C probably benign Het
Slc4a9 A G 18: 36,530,745 H274R probably benign Het
Slc5a6 T G 5: 31,039,335 E391D possibly damaging Het
Speer2 T C 16: 69,858,842 Q32R possibly damaging Het
Tars A G 15: 11,389,708 V372A probably benign Het
Thsd7a A T 6: 12,337,268 L1250Q possibly damaging Het
Tnnt3 A G 7: 142,512,564 Y222C probably benign Het
Trim40 T C 17: 36,888,983 I68V probably benign Het
Trp53tg5 T C 2: 164,471,306 I150V probably benign Het
Ube2u T C 4: 100,532,168 V109A probably benign Het
Usp54 A T 14: 20,561,840 D969E probably benign Het
Vil1 G T 1: 74,425,679 R495L probably benign Het
Wfs1 T A 5: 36,967,220 K700* probably null Het
Zcchc8 A G 5: 123,707,403 L298P probably damaging Het
Zfp946 A T 17: 22,454,716 Q150H possibly damaging Het
Other mutations in Cyp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Cyp1a1 APN 9 57700707 missense probably damaging 1.00
IGL02427:Cyp1a1 APN 9 57700575 missense probably damaging 1.00
IGL02952:Cyp1a1 APN 9 57702710 missense probably benign
IGL03002:Cyp1a1 APN 9 57702441 splice site probably benign
IGL03085:Cyp1a1 APN 9 57701712 missense possibly damaging 0.89
PIT1430001:Cyp1a1 UTSW 9 57700911 missense probably benign 0.27
R0508:Cyp1a1 UTSW 9 57700305 missense probably benign
R1844:Cyp1a1 UTSW 9 57702697 missense probably benign
R2394:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R3966:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R4056:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R4367:Cyp1a1 UTSW 9 57700149 missense probably benign
R4529:Cyp1a1 UTSW 9 57701679 missense probably benign 0.01
R4616:Cyp1a1 UTSW 9 57701756 missense probably benign 0.09
R4656:Cyp1a1 UTSW 9 57702610 missense probably damaging 0.99
R5271:Cyp1a1 UTSW 9 57702838 missense probably benign 0.01
R5324:Cyp1a1 UTSW 9 57702369 missense probably benign 0.13
R6113:Cyp1a1 UTSW 9 57701891 missense probably damaging 1.00
R6189:Cyp1a1 UTSW 9 57700683 missense probably damaging 1.00
R6239:Cyp1a1 UTSW 9 57702078 missense probably benign 0.36
R6382:Cyp1a1 UTSW 9 57700690 missense probably damaging 0.99
R6750:Cyp1a1 UTSW 9 57700256 missense probably benign
R6869:Cyp1a1 UTSW 9 57702784 missense probably benign
R6881:Cyp1a1 UTSW 9 57700719 missense possibly damaging 0.78
R6913:Cyp1a1 UTSW 9 57700293 missense probably damaging 0.98
R7341:Cyp1a1 UTSW 9 57700824 missense probably damaging 0.99
R7450:Cyp1a1 UTSW 9 57702132 missense probably damaging 0.99
R7938:Cyp1a1 UTSW 9 57701790 missense probably damaging 1.00
R8171:Cyp1a1 UTSW 9 57700196 missense probably benign
R8322:Cyp1a1 UTSW 9 57702720 missense probably damaging 0.97
Z1176:Cyp1a1 UTSW 9 57700594 missense probably benign 0.15
Z1177:Cyp1a1 UTSW 9 57700514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCGCATACCTAACCACTG -3'
(R):5'- GGGCTGTGTACACTAAACTGAG -3'

Sequencing Primer
(F):5'- TCAGGGTTTGACACAGTCAC -3'
(R):5'- GGCTGTGTACACTAAACTGAGATCTG -3'
Posted On2014-10-15