Incidental Mutation 'R2216:Aipl1'
ID241169
Institutional Source Beutler Lab
Gene Symbol Aipl1
Ensembl Gene ENSMUSG00000040554
Gene Namearyl hydrocarbon receptor-interacting protein-like 1
Synonyms
MMRRC Submission 040218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R2216 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72027963-72037509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 72031446 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 146 (P146T)
Ref Sequence ENSEMBL: ENSMUSP00000061957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048207] [ENSMUST00000059082]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048207
AA Change: P146T

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036279
Gene: ENSMUSG00000040554
AA Change: P146T

DomainStartEndE-ValueType
Pfam:FKBP_C 26 154 5.2e-8 PFAM
Pfam:TPR_2 178 210 4.6e-6 PFAM
low complexity region 240 251 N/A INTRINSIC
Pfam:TPR_2 264 296 5.5e-6 PFAM
low complexity region 302 312 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000059082
AA Change: P146T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061957
Gene: ENSMUSG00000040554
AA Change: P146T

DomainStartEndE-ValueType
Pfam:FKBP_C 25 154 1e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Leber congenital amaurosis (LCA) is the most severe inherited retinopathy with the earliest age of onset and accounts for at least 5% of all inherited retinal diseases. Affected individuals are diagnosed at birth or in the first few months of life with nystagmus, severely impaired vision or blindness and an abnormal or flat electroretinogram. The photoreceptor/pineal-expressed gene, AIPL1, encoding aryl-hydrocarbon interacting protein-like 1, is located within the LCA4 candidate region. The encoded protein contains three tetratricopeptide motifs, consistent with chaperone or nuclear transport activity. Mutations in this gene may cause approximately 20% of recessive LCA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display complete retinal degeneration and a lack of electroretinographic responses. Homozygous hypomorphic mutants display less severe retinal degeneration and impaired electroretinographic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arnt2 T A 7: 84,275,351 T423S probably damaging Het
Bend5 A G 4: 111,448,590 N277S probably null Het
Cd22 G T 7: 30,867,046 T816N probably damaging Het
Cep126 G A 9: 8,120,678 R115C probably damaging Het
Cep85 T C 4: 134,131,430 H710R possibly damaging Het
Cmya5 A T 13: 93,093,495 L1695H probably damaging Het
Col24a1 T C 3: 145,314,981 V371A probably benign Het
Csmd1 T A 8: 17,027,339 probably null Het
Cyp1a1 T A 9: 57,702,069 probably null Het
Dennd1c C T 17: 57,074,492 probably null Het
Dmxl1 G A 18: 49,893,923 V2033I probably benign Het
Dtna A G 18: 23,569,565 H51R probably damaging Het
Dysf G A 6: 84,207,245 probably null Het
Gcn1l1 T A 5: 115,593,661 V945E probably benign Het
Gm12800 T A 4: 101,910,060 W169R probably damaging Het
Gpbar1 C G 1: 74,278,894 L99V probably damaging Het
Hdac9 A T 12: 34,429,517 D212E probably damaging Het
Itga1 A T 13: 114,997,029 D448E probably benign Het
Itga2b T A 11: 102,467,866 N75I probably benign Het
Klra7 T C 6: 130,228,586 E117G probably benign Het
Kmt2b G A 7: 30,574,065 R2349C probably benign Het
Masp1 T C 16: 23,492,055 N209S probably benign Het
Mybpc2 C T 7: 44,512,500 probably null Het
Myh15 C G 16: 49,165,838 S1557* probably null Het
Myo3a A C 2: 22,577,771 T346P probably benign Het
Nim1k A G 13: 119,714,215 Y152H probably damaging Het
Nrp2 C T 1: 62,762,918 R507* probably null Het
Olfr513 C T 7: 108,755,612 T252M probably damaging Het
Olfr702 T A 7: 106,823,998 H176L probably damaging Het
Parp14 T C 16: 35,857,205 I798V probably benign Het
Pcnx2 C T 8: 125,888,077 A212T probably benign Het
Pkhd1l1 A T 15: 44,573,895 H3522L probably damaging Het
Pram1 C T 17: 33,641,284 A275V probably benign Het
Prkag1 A T 15: 98,815,946 M1K probably null Het
Prss52 T C 14: 64,113,593 S276P probably damaging Het
Ranbp17 A T 11: 33,481,125 V284D probably damaging Het
Reln T C 5: 22,048,005 D648G probably benign Het
Rnf112 A G 11: 61,452,279 L190P probably damaging Het
Scn5a G T 9: 119,485,612 P2010Q probably benign Het
Scn5a T C 9: 119,513,085 Y1138C probably benign Het
Slc4a9 A G 18: 36,530,745 H274R probably benign Het
Slc5a6 T G 5: 31,039,335 E391D possibly damaging Het
Speer2 T C 16: 69,858,842 Q32R possibly damaging Het
Tars A G 15: 11,389,708 V372A probably benign Het
Thsd7a A T 6: 12,337,268 L1250Q possibly damaging Het
Tnnt3 A G 7: 142,512,564 Y222C probably benign Het
Trim40 T C 17: 36,888,983 I68V probably benign Het
Trp53tg5 T C 2: 164,471,306 I150V probably benign Het
Ube2u T C 4: 100,532,168 V109A probably benign Het
Usp54 A T 14: 20,561,840 D969E probably benign Het
Vil1 G T 1: 74,425,679 R495L probably benign Het
Wfs1 T A 5: 36,967,220 K700* probably null Het
Zcchc8 A G 5: 123,707,403 L298P probably damaging Het
Zfp946 A T 17: 22,454,716 Q150H possibly damaging Het
Other mutations in Aipl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Aipl1 APN 11 72031547 missense probably damaging 1.00
IGL01713:Aipl1 APN 11 72036623 missense probably damaging 1.00
IGL02031:Aipl1 APN 11 72030202 utr 3 prime probably benign
IGL02603:Aipl1 APN 11 72036700 missense possibly damaging 0.82
IGL02677:Aipl1 APN 11 72029396 missense possibly damaging 0.90
R1563:Aipl1 UTSW 11 72036712 missense probably damaging 0.99
R1835:Aipl1 UTSW 11 72030499 missense possibly damaging 0.91
R2041:Aipl1 UTSW 11 72031506 missense possibly damaging 0.87
R2118:Aipl1 UTSW 11 72029369 missense possibly damaging 0.92
R4001:Aipl1 UTSW 11 72031602 missense probably damaging 1.00
R4969:Aipl1 UTSW 11 72031430 missense probably benign 0.22
R5428:Aipl1 UTSW 11 72030487 missense probably benign 0.02
R5933:Aipl1 UTSW 11 72030282 missense probably benign 0.01
R8151:Aipl1 UTSW 11 72036758 missense probably benign 0.44
R8379:Aipl1 UTSW 11 72029300 missense probably benign 0.05
R8406:Aipl1 UTSW 11 72031506 missense possibly damaging 0.87
X0018:Aipl1 UTSW 11 72030541 missense probably benign 0.00
Z1176:Aipl1 UTSW 11 72030533 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCCAAATGAGCCTTTTCCTAGTG -3'
(R):5'- CTCTGACAGCTGAGACATCC -3'

Sequencing Primer
(F):5'- AATGAGCCTTTTCCTAGTGGTGGG -3'
(R):5'- GCTGAGACATCCCCCTCCATATC -3'
Posted On2014-10-15