Mutagenetix > Incidental Mutation

Incidental Mutation 'R2216:Itga2b'

241170

Institutional Source

Beutler Lab

Gene Symbol

Itga2b

Ensembl Gene

ENSMUSG00000034664

Gene Name

integrin alpha 2b

Synonyms

platelet glycoprotein IIb, GpIIb, alphaIIb, GP IIb, CD41

MMRRC Submission

040218-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R2216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102453297-102470122 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102467866 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 75 (N75I)

Ref Sequence

ENSEMBL: ENSMUSP00000099375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103086]

AlphaFold

Q9QUM0

Predicted Effect

probably benign
Transcript: ENSMUST00000103086
AA Change: N75I

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664
AA Change: N75I

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Int_alpha	46	103	2.34e-10	SMART
Int_alpha	261	311	1.3e-3	SMART
Int_alpha	315	376	4.9e-13	SMART
Int_alpha	382	438	4.34e-14	SMART
Int_alpha	443	494	4.05e-5	SMART
low complexity region	552	567	N/A	INTRINSIC
SCOP:d1m1xa2	635	770	1e-48	SMART
SCOP:d1m1xa3	775	995	3e-66	SMART
Pfam:Integrin_alpha	1015	1029	5.7e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130757

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145925

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149519

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aipl1	G	T	11: 72,031,446	P146T	probably damaging	Het
Arnt2	T	A	7: 84,275,351	T423S	probably damaging	Het
Bend5	A	G	4: 111,448,590	N277S	probably null	Het
Cd22	G	T	7: 30,867,046	T816N	probably damaging	Het
Cep126	G	A	9: 8,120,678	R115C	probably damaging	Het
Cep85	T	C	4: 134,131,430	H710R	possibly damaging	Het
Cmya5	A	T	13: 93,093,495	L1695H	probably damaging	Het
Col24a1	T	C	3: 145,314,981	V371A	probably benign	Het
Csmd1	T	A	8: 17,027,339		probably null	Het
Cyp1a1	T	A	9: 57,702,069		probably null	Het
Dennd1c	C	T	17: 57,074,492		probably null	Het
Dmxl1	G	A	18: 49,893,923	V2033I	probably benign	Het
Dtna	A	G	18: 23,569,565	H51R	probably damaging	Het
Dysf	G	A	6: 84,207,245		probably null	Het
Gcn1l1	T	A	5: 115,593,661	V945E	probably benign	Het
Gm12800	T	A	4: 101,910,060	W169R	probably damaging	Het
Gpbar1	C	G	1: 74,278,894	L99V	probably damaging	Het
Hdac9	A	T	12: 34,429,517	D212E	probably damaging	Het
Itga1	A	T	13: 114,997,029	D448E	probably benign	Het
Klra7	T	C	6: 130,228,586	E117G	probably benign	Het
Kmt2b	G	A	7: 30,574,065	R2349C	probably benign	Het
Masp1	T	C	16: 23,492,055	N209S	probably benign	Het
Mybpc2	C	T	7: 44,512,500		probably null	Het
Myh15	C	G	16: 49,165,838	S1557*	probably null	Het
Myo3a	A	C	2: 22,577,771	T346P	probably benign	Het
Nim1k	A	G	13: 119,714,215	Y152H	probably damaging	Het
Nrp2	C	T	1: 62,762,918	R507*	probably null	Het
Olfr513	C	T	7: 108,755,612	T252M	probably damaging	Het
Olfr702	T	A	7: 106,823,998	H176L	probably damaging	Het
Parp14	T	C	16: 35,857,205	I798V	probably benign	Het
Pcnx2	C	T	8: 125,888,077	A212T	probably benign	Het
Pkhd1l1	A	T	15: 44,573,895	H3522L	probably damaging	Het
Pram1	C	T	17: 33,641,284	A275V	probably benign	Het
Prkag1	A	T	15: 98,815,946	M1K	probably null	Het
Prss52	T	C	14: 64,113,593	S276P	probably damaging	Het
Ranbp17	A	T	11: 33,481,125	V284D	probably damaging	Het
Reln	T	C	5: 22,048,005	D648G	probably benign	Het
Rnf112	A	G	11: 61,452,279	L190P	probably damaging	Het
Scn5a	G	T	9: 119,485,612	P2010Q	probably benign	Het
Scn5a	T	C	9: 119,513,085	Y1138C	probably benign	Het
Slc4a9	A	G	18: 36,530,745	H274R	probably benign	Het
Slc5a6	T	G	5: 31,039,335	E391D	possibly damaging	Het
Speer2	T	C	16: 69,858,842	Q32R	possibly damaging	Het
Tars	A	G	15: 11,389,708	V372A	probably benign	Het
Thsd7a	A	T	6: 12,337,268	L1250Q	possibly damaging	Het
Tnnt3	A	G	7: 142,512,564	Y222C	probably benign	Het
Trim40	T	C	17: 36,888,983	I68V	probably benign	Het
Trp53tg5	T	C	2: 164,471,306	I150V	probably benign	Het
Ube2u	T	C	4: 100,532,168	V109A	probably benign	Het
Usp54	A	T	14: 20,561,840	D969E	probably benign	Het
Vil1	G	T	1: 74,425,679	R495L	probably benign	Het
Wfs1	T	A	5: 36,967,220	K700*	probably null	Het
Zcchc8	A	G	5: 123,707,403	L298P	probably damaging	Het
Zfp946	A	T	17: 22,454,716	Q150H	possibly damaging	Het

Other mutations in Itga2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Itga2b	APN	11	102455583	missense	probably damaging	1.00
IGL02197:Itga2b	APN	11	102466319	missense	probably benign	0.19
IGL02349:Itga2b	APN	11	102461363	missense	probably damaging	0.98
IGL02711:Itga2b	APN	11	102465725	missense	possibly damaging	0.53
R0282:Itga2b	UTSW	11	102460846	missense	probably damaging	0.99
R0349:Itga2b	UTSW	11	102467426	missense	probably damaging	0.98
R0384:Itga2b	UTSW	11	102465362	splice site	probably null
R0403:Itga2b	UTSW	11	102467326	critical splice donor site	probably null
R0452:Itga2b	UTSW	11	102465953	splice site	probably null
R0535:Itga2b	UTSW	11	102457533	missense	possibly damaging	0.65
R1412:Itga2b	UTSW	11	102457005	missense	probably benign	0.00
R1517:Itga2b	UTSW	11	102466325	nonsense	probably null
R1615:Itga2b	UTSW	11	102460137	critical splice donor site	probably null
R1716:Itga2b	UTSW	11	102460777	missense	probably benign	0.30
R1953:Itga2b	UTSW	11	102458183	missense	probably benign	0.18
R2001:Itga2b	UTSW	11	102467339	missense	probably benign
R4193:Itga2b	UTSW	11	102469685	missense	probably benign	0.01
R4770:Itga2b	UTSW	11	102460756	missense	probably damaging	1.00
R4805:Itga2b	UTSW	11	102467866	missense	probably benign	0.00
R4880:Itga2b	UTSW	11	102457722	intron	probably benign
R4906:Itga2b	UTSW	11	102461159	missense	probably benign	0.43
R5112:Itga2b	UTSW	11	102458191	missense	probably damaging	0.99
R5362:Itga2b	UTSW	11	102461135	missense	probably damaging	0.99
R5739:Itga2b	UTSW	11	102465909	missense	probably benign	0.14
R5761:Itga2b	UTSW	11	102466274	missense	probably benign	0.00
R5840:Itga2b	UTSW	11	102461331	missense	probably damaging	1.00
R5851:Itga2b	UTSW	11	102457601	intron	probably benign
R6239:Itga2b	UTSW	11	102465318	missense	possibly damaging	0.61
R6491:Itga2b	UTSW	11	102459869	splice site	probably null
R7426:Itga2b	UTSW	11	102456294	missense	probably benign	0.01
R7635:Itga2b	UTSW	11	102461756	missense	probably damaging	1.00
R7664:Itga2b	UTSW	11	102460840	missense	probably damaging	1.00
R7832:Itga2b	UTSW	11	102457282	missense	probably damaging	0.98
R8120:Itga2b	UTSW	11	102469542	missense	probably damaging	0.98
R8254:Itga2b	UTSW	11	102467386	missense	probably benign	0.16
R8296:Itga2b	UTSW	11	102461159	missense	possibly damaging	0.79
R8362:Itga2b	UTSW	11	102461363	missense	probably damaging	1.00
R8815:Itga2b	UTSW	11	102460861	missense	possibly damaging	0.91
R8901:Itga2b	UTSW	11	102460804	missense	probably damaging	0.99
R8985:Itga2b	UTSW	11	102465462	intron	probably benign
R9277:Itga2b	UTSW	11	102461156	missense	probably damaging	1.00
R9335:Itga2b	UTSW	11	102455652	missense	probably damaging	0.99
R9496:Itga2b	UTSW	11	102467803	missense	probably damaging	1.00
R9779:Itga2b	UTSW	11	102457321	missense	probably damaging	1.00
Z1177:Itga2b	UTSW	11	102467076	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGCCTAGGTTTCGTGTC -3'
(R):5'- TCCACTTTCAGCTAAAATGAAGAGG -3'

Sequencing Primer
(F):5'- GAAGCCTAGGTTTCGTGTCTCATC -3'
(R):5'- TCAGCTAAAATGAAGAGGTTGTCC -3'

Posted On

2014-10-15