Incidental Mutation 'R2216:Itga2b'
ID241170
Institutional Source Beutler Lab
Gene Symbol Itga2b
Ensembl Gene ENSMUSG00000034664
Gene Nameintegrin alpha 2b
Synonymsplatelet glycoprotein IIb, GpIIb, alphaIIb, GP IIb, CD41
MMRRC Submission 040218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R2216 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102453297-102470122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102467866 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 75 (N75I)
Ref Sequence ENSEMBL: ENSMUSP00000099375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103086]
Predicted Effect probably benign
Transcript: ENSMUST00000103086
AA Change: N75I

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664
AA Change: N75I

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Int_alpha 46 103 2.34e-10 SMART
Int_alpha 261 311 1.3e-3 SMART
Int_alpha 315 376 4.9e-13 SMART
Int_alpha 382 438 4.34e-14 SMART
Int_alpha 443 494 4.05e-5 SMART
low complexity region 552 567 N/A INTRINSIC
SCOP:d1m1xa2 635 770 1e-48 SMART
SCOP:d1m1xa3 775 995 3e-66 SMART
Pfam:Integrin_alpha 1015 1029 5.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149519
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 72,031,446 P146T probably damaging Het
Arnt2 T A 7: 84,275,351 T423S probably damaging Het
Bend5 A G 4: 111,448,590 N277S probably null Het
Cd22 G T 7: 30,867,046 T816N probably damaging Het
Cep126 G A 9: 8,120,678 R115C probably damaging Het
Cep85 T C 4: 134,131,430 H710R possibly damaging Het
Cmya5 A T 13: 93,093,495 L1695H probably damaging Het
Col24a1 T C 3: 145,314,981 V371A probably benign Het
Csmd1 T A 8: 17,027,339 probably null Het
Cyp1a1 T A 9: 57,702,069 probably null Het
Dennd1c C T 17: 57,074,492 probably null Het
Dmxl1 G A 18: 49,893,923 V2033I probably benign Het
Dtna A G 18: 23,569,565 H51R probably damaging Het
Dysf G A 6: 84,207,245 probably null Het
Gcn1l1 T A 5: 115,593,661 V945E probably benign Het
Gm12800 T A 4: 101,910,060 W169R probably damaging Het
Gpbar1 C G 1: 74,278,894 L99V probably damaging Het
Hdac9 A T 12: 34,429,517 D212E probably damaging Het
Itga1 A T 13: 114,997,029 D448E probably benign Het
Klra7 T C 6: 130,228,586 E117G probably benign Het
Kmt2b G A 7: 30,574,065 R2349C probably benign Het
Masp1 T C 16: 23,492,055 N209S probably benign Het
Mybpc2 C T 7: 44,512,500 probably null Het
Myh15 C G 16: 49,165,838 S1557* probably null Het
Myo3a A C 2: 22,577,771 T346P probably benign Het
Nim1k A G 13: 119,714,215 Y152H probably damaging Het
Nrp2 C T 1: 62,762,918 R507* probably null Het
Olfr513 C T 7: 108,755,612 T252M probably damaging Het
Olfr702 T A 7: 106,823,998 H176L probably damaging Het
Parp14 T C 16: 35,857,205 I798V probably benign Het
Pcnx2 C T 8: 125,888,077 A212T probably benign Het
Pkhd1l1 A T 15: 44,573,895 H3522L probably damaging Het
Pram1 C T 17: 33,641,284 A275V probably benign Het
Prkag1 A T 15: 98,815,946 M1K probably null Het
Prss52 T C 14: 64,113,593 S276P probably damaging Het
Ranbp17 A T 11: 33,481,125 V284D probably damaging Het
Reln T C 5: 22,048,005 D648G probably benign Het
Rnf112 A G 11: 61,452,279 L190P probably damaging Het
Scn5a G T 9: 119,485,612 P2010Q probably benign Het
Scn5a T C 9: 119,513,085 Y1138C probably benign Het
Slc4a9 A G 18: 36,530,745 H274R probably benign Het
Slc5a6 T G 5: 31,039,335 E391D possibly damaging Het
Speer2 T C 16: 69,858,842 Q32R possibly damaging Het
Tars A G 15: 11,389,708 V372A probably benign Het
Thsd7a A T 6: 12,337,268 L1250Q possibly damaging Het
Tnnt3 A G 7: 142,512,564 Y222C probably benign Het
Trim40 T C 17: 36,888,983 I68V probably benign Het
Trp53tg5 T C 2: 164,471,306 I150V probably benign Het
Ube2u T C 4: 100,532,168 V109A probably benign Het
Usp54 A T 14: 20,561,840 D969E probably benign Het
Vil1 G T 1: 74,425,679 R495L probably benign Het
Wfs1 T A 5: 36,967,220 K700* probably null Het
Zcchc8 A G 5: 123,707,403 L298P probably damaging Het
Zfp946 A T 17: 22,454,716 Q150H possibly damaging Het
Other mutations in Itga2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Itga2b APN 11 102455583 missense probably damaging 1.00
IGL02197:Itga2b APN 11 102466319 missense probably benign 0.19
IGL02349:Itga2b APN 11 102461363 missense probably damaging 0.98
IGL02711:Itga2b APN 11 102465725 missense possibly damaging 0.53
R0282:Itga2b UTSW 11 102460846 missense probably damaging 0.99
R0349:Itga2b UTSW 11 102467426 missense probably damaging 0.98
R0384:Itga2b UTSW 11 102465362 splice site probably null
R0403:Itga2b UTSW 11 102467326 critical splice donor site probably null
R0452:Itga2b UTSW 11 102465953 splice site probably null
R0535:Itga2b UTSW 11 102457533 missense possibly damaging 0.65
R1412:Itga2b UTSW 11 102457005 missense probably benign 0.00
R1517:Itga2b UTSW 11 102466325 nonsense probably null
R1615:Itga2b UTSW 11 102460137 critical splice donor site probably null
R1716:Itga2b UTSW 11 102460777 missense probably benign 0.30
R1953:Itga2b UTSW 11 102458183 missense probably benign 0.18
R2001:Itga2b UTSW 11 102467339 missense probably benign
R4193:Itga2b UTSW 11 102469685 missense probably benign 0.01
R4770:Itga2b UTSW 11 102460756 missense probably damaging 1.00
R4805:Itga2b UTSW 11 102467866 missense probably benign 0.00
R4880:Itga2b UTSW 11 102457722 intron probably benign
R4906:Itga2b UTSW 11 102461159 missense probably benign 0.43
R5112:Itga2b UTSW 11 102458191 missense probably damaging 0.99
R5362:Itga2b UTSW 11 102461135 missense probably damaging 0.99
R5739:Itga2b UTSW 11 102465909 missense probably benign 0.14
R5761:Itga2b UTSW 11 102466274 missense probably benign 0.00
R5840:Itga2b UTSW 11 102461331 missense probably damaging 1.00
R5851:Itga2b UTSW 11 102457601 intron probably benign
R6239:Itga2b UTSW 11 102465318 missense possibly damaging 0.61
R6491:Itga2b UTSW 11 102459869 splice site probably null
R7426:Itga2b UTSW 11 102456294 missense probably benign 0.01
R7635:Itga2b UTSW 11 102461756 missense probably damaging 1.00
R7664:Itga2b UTSW 11 102460840 missense probably damaging 1.00
R7832:Itga2b UTSW 11 102457282 missense probably damaging 0.98
R8120:Itga2b UTSW 11 102469542 missense probably damaging 0.98
R8254:Itga2b UTSW 11 102467386 missense probably benign 0.16
R8296:Itga2b UTSW 11 102461159 missense possibly damaging 0.79
R8362:Itga2b UTSW 11 102461363 missense probably damaging 1.00
Z1177:Itga2b UTSW 11 102467076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGCCTAGGTTTCGTGTC -3'
(R):5'- TCCACTTTCAGCTAAAATGAAGAGG -3'

Sequencing Primer
(F):5'- GAAGCCTAGGTTTCGTGTCTCATC -3'
(R):5'- TCAGCTAAAATGAAGAGGTTGTCC -3'
Posted On2014-10-15