Incidental Mutation 'R2216:Hdac9'
ID 241171
Institutional Source Beutler Lab
Gene Symbol Hdac9
Ensembl Gene ENSMUSG00000004698
Gene Name histone deacetylase 9
Synonyms HDRP, Mitr, Hdac7b, D030072B18Rik
MMRRC Submission 040218-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2216 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 34097579-34967094 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34479516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 212 (D212E)
Ref Sequence ENSEMBL: ENSMUSP00000147519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110819] [ENSMUST00000209463] [ENSMUST00000209667] [ENSMUST00000209750] [ENSMUST00000209902] [ENSMUST00000209990] [ENSMUST00000211107] [ENSMUST00000210724] [ENSMUST00000211752]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110819
AA Change: D212E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106443
Gene: ENSMUSG00000004698
AA Change: D212E

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 37 124 5.4e-36 PFAM
low complexity region 260 284 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209463
Predicted Effect possibly damaging
Transcript: ENSMUST00000209667
AA Change: D212E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000209750
AA Change: D215E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000209902
AA Change: D212E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000209990
AA Change: D215E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211107
AA Change: D184E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000210724
AA Change: D212E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211752
AA Change: D236E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211632
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 71,922,272 (GRCm39) P146T probably damaging Het
Arnt2 T A 7: 83,924,559 (GRCm39) T423S probably damaging Het
Bend5 A G 4: 111,305,787 (GRCm39) N277S probably null Het
Cd22 G T 7: 30,566,471 (GRCm39) T816N probably damaging Het
Cep126 G A 9: 8,120,679 (GRCm39) R115C probably damaging Het
Cep85 T C 4: 133,858,741 (GRCm39) H710R possibly damaging Het
Cmya5 A T 13: 93,230,003 (GRCm39) L1695H probably damaging Het
Col24a1 T C 3: 145,020,742 (GRCm39) V371A probably benign Het
Csmd1 T A 8: 17,077,355 (GRCm39) probably null Het
Cyp1a1 T A 9: 57,609,352 (GRCm39) probably null Het
Dennd1c C T 17: 57,381,492 (GRCm39) probably null Het
Dmxl1 G A 18: 50,026,990 (GRCm39) V2033I probably benign Het
Dtna A G 18: 23,702,622 (GRCm39) H51R probably damaging Het
Dysf G A 6: 84,184,227 (GRCm39) probably null Het
Gcn1 T A 5: 115,731,720 (GRCm39) V945E probably benign Het
Gpbar1 C G 1: 74,318,053 (GRCm39) L99V probably damaging Het
Itga1 A T 13: 115,133,565 (GRCm39) D448E probably benign Het
Itga2b T A 11: 102,358,692 (GRCm39) N75I probably benign Het
Klra7 T C 6: 130,205,549 (GRCm39) E117G probably benign Het
Kmt2b G A 7: 30,273,490 (GRCm39) R2349C probably benign Het
Masp1 T C 16: 23,310,805 (GRCm39) N209S probably benign Het
Mybpc2 C T 7: 44,161,924 (GRCm39) probably null Het
Myh15 C G 16: 48,986,201 (GRCm39) S1557* probably null Het
Myo3a A C 2: 22,467,783 (GRCm39) T346P probably benign Het
Nim1k A G 13: 120,175,751 (GRCm39) Y152H probably damaging Het
Nrp2 C T 1: 62,802,077 (GRCm39) R507* probably null Het
Or13n4 T A 7: 106,423,205 (GRCm39) H176L probably damaging Het
Or5e1 C T 7: 108,354,819 (GRCm39) T252M probably damaging Het
Parp14 T C 16: 35,677,575 (GRCm39) I798V probably benign Het
Pcnx2 C T 8: 126,614,816 (GRCm39) A212T probably benign Het
Pkhd1l1 A T 15: 44,437,291 (GRCm39) H3522L probably damaging Het
Pram1 C T 17: 33,860,258 (GRCm39) A275V probably benign Het
Pramel18 T A 4: 101,767,257 (GRCm39) W169R probably damaging Het
Prkag1 A T 15: 98,713,827 (GRCm39) M1K probably null Het
Prss52 T C 14: 64,351,042 (GRCm39) S276P probably damaging Het
Ranbp17 A T 11: 33,431,125 (GRCm39) V284D probably damaging Het
Reln T C 5: 22,253,003 (GRCm39) D648G probably benign Het
Rnf112 A G 11: 61,343,105 (GRCm39) L190P probably damaging Het
Scn5a G T 9: 119,314,678 (GRCm39) P2010Q probably benign Het
Scn5a T C 9: 119,342,151 (GRCm39) Y1138C probably benign Het
Slc4a9 A G 18: 36,663,798 (GRCm39) H274R probably benign Het
Slc5a6 T G 5: 31,196,679 (GRCm39) E391D possibly damaging Het
Speer2 T C 16: 69,655,730 (GRCm39) Q32R possibly damaging Het
Tars1 A G 15: 11,389,794 (GRCm39) V372A probably benign Het
Thsd7a A T 6: 12,337,267 (GRCm39) L1250Q possibly damaging Het
Tnnt3 A G 7: 142,066,301 (GRCm39) Y222C probably benign Het
Trim40 T C 17: 37,199,875 (GRCm39) I68V probably benign Het
Trp53tg5 T C 2: 164,313,226 (GRCm39) I150V probably benign Het
Ube2u T C 4: 100,389,365 (GRCm39) V109A probably benign Het
Usp54 A T 14: 20,611,908 (GRCm39) D969E probably benign Het
Vil1 G T 1: 74,464,838 (GRCm39) R495L probably benign Het
Wfs1 T A 5: 37,124,564 (GRCm39) K700* probably null Het
Zcchc8 A G 5: 123,845,466 (GRCm39) L298P probably damaging Het
Zfp946 A T 17: 22,673,697 (GRCm39) Q150H possibly damaging Het
Other mutations in Hdac9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Hdac9 APN 12 34,479,488 (GRCm39) splice site probably benign
IGL01484:Hdac9 APN 12 34,487,164 (GRCm39) missense probably damaging 1.00
IGL02010:Hdac9 APN 12 34,481,944 (GRCm39) missense probably damaging 1.00
IGL02059:Hdac9 APN 12 34,481,967 (GRCm39) missense probably damaging 0.97
IGL02276:Hdac9 APN 12 34,481,925 (GRCm39) missense probably damaging 1.00
IGL02797:Hdac9 APN 12 34,443,273 (GRCm39) splice site probably benign
IGL03202:Hdac9 APN 12 34,423,950 (GRCm39) missense probably damaging 1.00
PIT4468001:Hdac9 UTSW 12 34,145,933 (GRCm39) missense unknown
R0304:Hdac9 UTSW 12 34,424,110 (GRCm39) missense probably damaging 1.00
R0432:Hdac9 UTSW 12 34,487,221 (GRCm39) missense probably damaging 1.00
R0659:Hdac9 UTSW 12 34,487,221 (GRCm39) missense probably damaging 1.00
R1826:Hdac9 UTSW 12 34,479,491 (GRCm39) splice site probably benign
R1879:Hdac9 UTSW 12 34,440,332 (GRCm39) missense probably damaging 0.98
R1942:Hdac9 UTSW 12 34,479,544 (GRCm39) missense probably damaging 1.00
R2113:Hdac9 UTSW 12 34,439,331 (GRCm39) missense probably damaging 1.00
R2151:Hdac9 UTSW 12 34,440,255 (GRCm39) missense probably damaging 1.00
R2224:Hdac9 UTSW 12 34,457,801 (GRCm39) missense probably benign 0.09
R2225:Hdac9 UTSW 12 34,457,801 (GRCm39) missense probably benign 0.09
R2227:Hdac9 UTSW 12 34,457,801 (GRCm39) missense probably benign 0.09
R3500:Hdac9 UTSW 12 34,487,352 (GRCm39) missense probably benign 0.01
R4441:Hdac9 UTSW 12 34,439,375 (GRCm39) missense probably damaging 1.00
R4674:Hdac9 UTSW 12 34,423,959 (GRCm39) missense possibly damaging 0.96
R4694:Hdac9 UTSW 12 34,487,246 (GRCm39) missense probably damaging 1.00
R5033:Hdac9 UTSW 12 34,423,906 (GRCm39) missense probably benign
R5229:Hdac9 UTSW 12 34,487,163 (GRCm39) missense probably damaging 1.00
R5353:Hdac9 UTSW 12 34,443,392 (GRCm39) nonsense probably null
R5384:Hdac9 UTSW 12 34,479,557 (GRCm39) missense probably damaging 1.00
R5958:Hdac9 UTSW 12 34,423,882 (GRCm39) missense probably damaging 0.97
R6129:Hdac9 UTSW 12 34,337,474 (GRCm39) missense probably damaging 1.00
R6157:Hdac9 UTSW 12 34,439,428 (GRCm39) missense probably damaging 1.00
R6248:Hdac9 UTSW 12 34,578,293 (GRCm39) missense possibly damaging 0.79
R6333:Hdac9 UTSW 12 34,102,323 (GRCm39) missense probably damaging 0.98
R6474:Hdac9 UTSW 12 34,481,990 (GRCm39) critical splice acceptor site probably null
R6589:Hdac9 UTSW 12 34,265,028 (GRCm39) missense probably damaging 1.00
R6737:Hdac9 UTSW 12 34,265,451 (GRCm39) missense probably damaging 1.00
R6767:Hdac9 UTSW 12 34,337,528 (GRCm39) missense probably damaging 1.00
R6837:Hdac9 UTSW 12 34,337,463 (GRCm39) missense probably benign 0.12
R6857:Hdac9 UTSW 12 34,443,362 (GRCm39) missense probably benign 0.37
R7069:Hdac9 UTSW 12 34,479,548 (GRCm39) missense possibly damaging 0.92
R7237:Hdac9 UTSW 12 34,424,139 (GRCm39) critical splice acceptor site probably null
R7768:Hdac9 UTSW 12 34,440,239 (GRCm39) missense possibly damaging 0.81
R7917:Hdac9 UTSW 12 34,483,209 (GRCm39) missense probably benign 0.31
R7974:Hdac9 UTSW 12 34,353,219 (GRCm39) missense possibly damaging 0.87
R7990:Hdac9 UTSW 12 34,265,452 (GRCm39) missense probably benign 0.05
R8489:Hdac9 UTSW 12 34,487,180 (GRCm39) missense probably damaging 1.00
R8683:Hdac9 UTSW 12 34,440,220 (GRCm39) missense probably damaging 1.00
R9208:Hdac9 UTSW 12 34,220,101 (GRCm39) missense probably benign 0.01
R9397:Hdac9 UTSW 12 34,353,275 (GRCm39) missense probably damaging 0.99
R9431:Hdac9 UTSW 12 34,440,327 (GRCm39) nonsense probably null
R9629:Hdac9 UTSW 12 34,439,389 (GRCm39) missense probably damaging 0.99
R9646:Hdac9 UTSW 12 34,487,167 (GRCm39) missense probably damaging 1.00
R9709:Hdac9 UTSW 12 34,362,602 (GRCm39) missense probably benign 0.21
Z1088:Hdac9 UTSW 12 34,457,788 (GRCm39) missense probably damaging 1.00
Z1176:Hdac9 UTSW 12 34,423,986 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTCTGTATATCTAGGAATTGTGTC -3'
(R):5'- GACATAAATGCAGCCGAGGC -3'

Sequencing Primer
(F):5'- ATCTAGGAATTGTGTCTGCATGTGC -3'
(R):5'- CAGCATGGGAAACTGAGTATTTGTG -3'
Posted On 2014-10-15