Incidental Mutation 'R2216:Itga1'
ID 241173
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Name integrin alpha 1
Synonyms E130012M19Rik, CD49A, Vla1
MMRRC Submission 040218-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.254) question?
Stock # R2216 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 115094615-115238500 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115133565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 448 (D448E)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
AlphaFold Q3V3R4
Predicted Effect probably benign
Transcript: ENSMUST00000061673
AA Change: D448E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: D448E

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224865
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 71,922,272 (GRCm39) P146T probably damaging Het
Arnt2 T A 7: 83,924,559 (GRCm39) T423S probably damaging Het
Bend5 A G 4: 111,305,787 (GRCm39) N277S probably null Het
Cd22 G T 7: 30,566,471 (GRCm39) T816N probably damaging Het
Cep126 G A 9: 8,120,679 (GRCm39) R115C probably damaging Het
Cep85 T C 4: 133,858,741 (GRCm39) H710R possibly damaging Het
Cmya5 A T 13: 93,230,003 (GRCm39) L1695H probably damaging Het
Col24a1 T C 3: 145,020,742 (GRCm39) V371A probably benign Het
Csmd1 T A 8: 17,077,355 (GRCm39) probably null Het
Cyp1a1 T A 9: 57,609,352 (GRCm39) probably null Het
Dennd1c C T 17: 57,381,492 (GRCm39) probably null Het
Dmxl1 G A 18: 50,026,990 (GRCm39) V2033I probably benign Het
Dtna A G 18: 23,702,622 (GRCm39) H51R probably damaging Het
Dysf G A 6: 84,184,227 (GRCm39) probably null Het
Gcn1 T A 5: 115,731,720 (GRCm39) V945E probably benign Het
Gpbar1 C G 1: 74,318,053 (GRCm39) L99V probably damaging Het
Hdac9 A T 12: 34,479,516 (GRCm39) D212E probably damaging Het
Itga2b T A 11: 102,358,692 (GRCm39) N75I probably benign Het
Klra7 T C 6: 130,205,549 (GRCm39) E117G probably benign Het
Kmt2b G A 7: 30,273,490 (GRCm39) R2349C probably benign Het
Masp1 T C 16: 23,310,805 (GRCm39) N209S probably benign Het
Mybpc2 C T 7: 44,161,924 (GRCm39) probably null Het
Myh15 C G 16: 48,986,201 (GRCm39) S1557* probably null Het
Myo3a A C 2: 22,467,783 (GRCm39) T346P probably benign Het
Nim1k A G 13: 120,175,751 (GRCm39) Y152H probably damaging Het
Nrp2 C T 1: 62,802,077 (GRCm39) R507* probably null Het
Or13n4 T A 7: 106,423,205 (GRCm39) H176L probably damaging Het
Or5e1 C T 7: 108,354,819 (GRCm39) T252M probably damaging Het
Parp14 T C 16: 35,677,575 (GRCm39) I798V probably benign Het
Pcnx2 C T 8: 126,614,816 (GRCm39) A212T probably benign Het
Pkhd1l1 A T 15: 44,437,291 (GRCm39) H3522L probably damaging Het
Pram1 C T 17: 33,860,258 (GRCm39) A275V probably benign Het
Pramel18 T A 4: 101,767,257 (GRCm39) W169R probably damaging Het
Prkag1 A T 15: 98,713,827 (GRCm39) M1K probably null Het
Prss52 T C 14: 64,351,042 (GRCm39) S276P probably damaging Het
Ranbp17 A T 11: 33,431,125 (GRCm39) V284D probably damaging Het
Reln T C 5: 22,253,003 (GRCm39) D648G probably benign Het
Rnf112 A G 11: 61,343,105 (GRCm39) L190P probably damaging Het
Scn5a G T 9: 119,314,678 (GRCm39) P2010Q probably benign Het
Scn5a T C 9: 119,342,151 (GRCm39) Y1138C probably benign Het
Slc4a9 A G 18: 36,663,798 (GRCm39) H274R probably benign Het
Slc5a6 T G 5: 31,196,679 (GRCm39) E391D possibly damaging Het
Speer2 T C 16: 69,655,730 (GRCm39) Q32R possibly damaging Het
Tars1 A G 15: 11,389,794 (GRCm39) V372A probably benign Het
Thsd7a A T 6: 12,337,267 (GRCm39) L1250Q possibly damaging Het
Tnnt3 A G 7: 142,066,301 (GRCm39) Y222C probably benign Het
Trim40 T C 17: 37,199,875 (GRCm39) I68V probably benign Het
Trp53tg5 T C 2: 164,313,226 (GRCm39) I150V probably benign Het
Ube2u T C 4: 100,389,365 (GRCm39) V109A probably benign Het
Usp54 A T 14: 20,611,908 (GRCm39) D969E probably benign Het
Vil1 G T 1: 74,464,838 (GRCm39) R495L probably benign Het
Wfs1 T A 5: 37,124,564 (GRCm39) K700* probably null Het
Zcchc8 A G 5: 123,845,466 (GRCm39) L298P probably damaging Het
Zfp946 A T 17: 22,673,697 (GRCm39) Q150H possibly damaging Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 115,128,899 (GRCm39) missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115,167,729 (GRCm39) missense probably benign 0.00
IGL00549:Itga1 APN 13 115,185,832 (GRCm39) missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115,148,785 (GRCm39) missense probably damaging 1.00
IGL01021:Itga1 APN 13 115,133,536 (GRCm39) missense probably benign 0.29
IGL01289:Itga1 APN 13 115,122,762 (GRCm39) missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115,143,484 (GRCm39) missense possibly damaging 0.73
IGL01791:Itga1 APN 13 115,124,197 (GRCm39) missense probably benign 0.00
IGL01796:Itga1 APN 13 115,121,657 (GRCm39) missense probably damaging 1.00
IGL02027:Itga1 APN 13 115,126,591 (GRCm39) splice site probably null
IGL02330:Itga1 APN 13 115,148,740 (GRCm39) missense probably damaging 1.00
IGL02480:Itga1 APN 13 115,124,184 (GRCm39) missense probably damaging 1.00
IGL02943:Itga1 APN 13 115,185,832 (GRCm39) missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115,152,790 (GRCm39) missense probably benign 0.40
R0103:Itga1 UTSW 13 115,152,790 (GRCm39) missense probably benign 0.40
R0244:Itga1 UTSW 13 115,143,433 (GRCm39) splice site probably benign
R0265:Itga1 UTSW 13 115,128,995 (GRCm39) missense probably benign
R0302:Itga1 UTSW 13 115,148,854 (GRCm39) splice site probably benign
R0320:Itga1 UTSW 13 115,114,130 (GRCm39) splice site probably benign
R0389:Itga1 UTSW 13 115,128,996 (GRCm39) missense probably benign 0.04
R0443:Itga1 UTSW 13 115,128,996 (GRCm39) missense probably benign 0.04
R0574:Itga1 UTSW 13 115,103,097 (GRCm39) missense probably damaging 1.00
R0646:Itga1 UTSW 13 115,104,835 (GRCm39) missense probably benign
R0830:Itga1 UTSW 13 115,143,568 (GRCm39) missense probably benign 0.08
R2162:Itga1 UTSW 13 115,167,446 (GRCm39) missense probably benign 0.23
R2403:Itga1 UTSW 13 115,114,150 (GRCm39) missense probably benign 0.00
R3734:Itga1 UTSW 13 115,114,175 (GRCm39) missense probably benign
R4171:Itga1 UTSW 13 115,167,422 (GRCm39) nonsense probably null
R4402:Itga1 UTSW 13 115,138,102 (GRCm39) missense probably benign 0.00
R4675:Itga1 UTSW 13 115,138,227 (GRCm39) splice site probably null
R4684:Itga1 UTSW 13 115,185,906 (GRCm39) missense probably damaging 1.00
R4795:Itga1 UTSW 13 115,171,921 (GRCm39) missense probably damaging 1.00
R4796:Itga1 UTSW 13 115,171,921 (GRCm39) missense probably damaging 1.00
R4845:Itga1 UTSW 13 115,110,708 (GRCm39) nonsense probably null
R5147:Itga1 UTSW 13 115,121,678 (GRCm39) missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115,171,839 (GRCm39) missense probably benign
R5234:Itga1 UTSW 13 115,185,839 (GRCm39) nonsense probably null
R5344:Itga1 UTSW 13 115,138,845 (GRCm39) missense possibly damaging 0.78
R5554:Itga1 UTSW 13 115,129,010 (GRCm39) nonsense probably null
R5662:Itga1 UTSW 13 115,122,707 (GRCm39) missense probably benign 0.03
R5945:Itga1 UTSW 13 115,103,126 (GRCm39) missense probably benign 0.02
R6150:Itga1 UTSW 13 115,104,769 (GRCm39) missense probably benign 0.01
R6241:Itga1 UTSW 13 115,096,673 (GRCm39) splice site probably null
R6276:Itga1 UTSW 13 115,117,388 (GRCm39) missense probably benign
R6369:Itga1 UTSW 13 115,102,196 (GRCm39) missense probably damaging 1.00
R6511:Itga1 UTSW 13 115,129,037 (GRCm39) missense probably damaging 0.98
R6663:Itga1 UTSW 13 115,110,641 (GRCm39) missense probably benign 0.02
R6783:Itga1 UTSW 13 115,133,513 (GRCm39) missense probably benign 0.22
R6931:Itga1 UTSW 13 115,138,099 (GRCm39) missense probably benign 0.39
R7069:Itga1 UTSW 13 115,104,776 (GRCm39) missense probably damaging 1.00
R7458:Itga1 UTSW 13 115,122,802 (GRCm39) missense probably benign 0.00
R7588:Itga1 UTSW 13 115,104,785 (GRCm39) missense possibly damaging 0.88
R7591:Itga1 UTSW 13 115,119,315 (GRCm39) missense probably damaging 1.00
R7597:Itga1 UTSW 13 115,110,676 (GRCm39) missense probably benign 0.28
R7615:Itga1 UTSW 13 115,133,458 (GRCm39) missense probably null 0.99
R7756:Itga1 UTSW 13 115,128,996 (GRCm39) missense probably benign 0.04
R7795:Itga1 UTSW 13 115,148,772 (GRCm39) missense probably damaging 1.00
R7819:Itga1 UTSW 13 115,185,837 (GRCm39) missense probably damaging 0.99
R8193:Itga1 UTSW 13 115,104,991 (GRCm39) critical splice donor site probably null
R8313:Itga1 UTSW 13 115,103,120 (GRCm39) missense probably benign 0.06
R8419:Itga1 UTSW 13 115,143,604 (GRCm39) missense probably damaging 1.00
R8925:Itga1 UTSW 13 115,105,055 (GRCm39) missense probably benign 0.01
R8927:Itga1 UTSW 13 115,105,055 (GRCm39) missense probably benign 0.01
R8951:Itga1 UTSW 13 115,107,027 (GRCm39) nonsense probably null
R9099:Itga1 UTSW 13 115,185,856 (GRCm39) missense probably damaging 1.00
R9200:Itga1 UTSW 13 115,104,997 (GRCm39) missense possibly damaging 0.80
R9221:Itga1 UTSW 13 115,166,695 (GRCm39) nonsense probably null
R9249:Itga1 UTSW 13 115,185,834 (GRCm39) missense probably damaging 1.00
R9267:Itga1 UTSW 13 115,185,924 (GRCm39) missense possibly damaging 0.50
R9376:Itga1 UTSW 13 115,107,112 (GRCm39) missense probably benign 0.07
R9481:Itga1 UTSW 13 115,152,753 (GRCm39) missense probably benign 0.34
R9789:Itga1 UTSW 13 115,171,820 (GRCm39) nonsense probably null
Z1177:Itga1 UTSW 13 115,121,607 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCAAGGGATCAACTAGAAAGC -3'
(R):5'- GCAGCACAGGAAAGACGTTTC -3'

Sequencing Primer
(F):5'- GGGATCAACTAGAAAGCCTTCTTC -3'
(R):5'- GGAAAGACGTTTCACCAACAC -3'
Posted On 2014-10-15