Mutagenetix > Incidental Mutations

Incidental Mutation 'R2216:Tars'

241177

Institutional Source

Beutler Lab

Gene Symbol

Tars

Ensembl Gene

ENSMUSG00000022241

Gene Name

threonyl-tRNA synthetase

Synonyms

D15Wsu59e, ThrRS

MMRRC Submission

040218-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R2216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11382301-11399665 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11389708 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 372 (V372A)

Ref Sequence

ENSEMBL: ENSMUSP00000022849 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022849] [ENSMUST00000228814]

AlphaFold

Q9D0R2

Predicted Effect

probably benign
Transcript: ENSMUST00000022849
AA Change: V372A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000022849
Gene: ENSMUSG00000022241
AA Change: V372A

Domain	Start	End	E-Value	Type
low complexity region	21	45	N/A	INTRINSIC
Pfam:TGS	82	142	7.5e-18	PFAM
tRNA_SAD	248	297	1.91e-16	SMART
Pfam:tRNA-synt_2b	396	607	5e-38	PFAM
Pfam:HGTP_anticodon	619	710	6.5e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226597

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226904

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226944

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228710

Predicted Effect

probably benign
Transcript: ENSMUST00000228814

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Threonyl-tRNA synthetase belongs to the class-II aminoacyl-tRNA synthetase family [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aipl1	G	T	11: 72,031,446	P146T	probably damaging	Het
Arnt2	T	A	7: 84,275,351	T423S	probably damaging	Het
Bend5	A	G	4: 111,448,590	N277S	probably null	Het
Cd22	G	T	7: 30,867,046	T816N	probably damaging	Het
Cep126	G	A	9: 8,120,678	R115C	probably damaging	Het
Cep85	T	C	4: 134,131,430	H710R	possibly damaging	Het
Cmya5	A	T	13: 93,093,495	L1695H	probably damaging	Het
Col24a1	T	C	3: 145,314,981	V371A	probably benign	Het
Csmd1	T	A	8: 17,027,339		probably null	Het
Cyp1a1	T	A	9: 57,702,069		probably null	Het
Dennd1c	C	T	17: 57,074,492		probably null	Het
Dmxl1	G	A	18: 49,893,923	V2033I	probably benign	Het
Dtna	A	G	18: 23,569,565	H51R	probably damaging	Het
Dysf	G	A	6: 84,207,245		probably null	Het
Gcn1l1	T	A	5: 115,593,661	V945E	probably benign	Het
Gm12800	T	A	4: 101,910,060	W169R	probably damaging	Het
Gpbar1	C	G	1: 74,278,894	L99V	probably damaging	Het
Hdac9	A	T	12: 34,429,517	D212E	probably damaging	Het
Itga1	A	T	13: 114,997,029	D448E	probably benign	Het
Itga2b	T	A	11: 102,467,866	N75I	probably benign	Het
Klra7	T	C	6: 130,228,586	E117G	probably benign	Het
Kmt2b	G	A	7: 30,574,065	R2349C	probably benign	Het
Masp1	T	C	16: 23,492,055	N209S	probably benign	Het
Mybpc2	C	T	7: 44,512,500		probably null	Het
Myh15	C	G	16: 49,165,838	S1557*	probably null	Het
Myo3a	A	C	2: 22,577,771	T346P	probably benign	Het
Nim1k	A	G	13: 119,714,215	Y152H	probably damaging	Het
Nrp2	C	T	1: 62,762,918	R507*	probably null	Het
Olfr513	C	T	7: 108,755,612	T252M	probably damaging	Het
Olfr702	T	A	7: 106,823,998	H176L	probably damaging	Het
Parp14	T	C	16: 35,857,205	I798V	probably benign	Het
Pcnx2	C	T	8: 125,888,077	A212T	probably benign	Het
Pkhd1l1	A	T	15: 44,573,895	H3522L	probably damaging	Het
Pram1	C	T	17: 33,641,284	A275V	probably benign	Het
Prkag1	A	T	15: 98,815,946	M1K	probably null	Het
Prss52	T	C	14: 64,113,593	S276P	probably damaging	Het
Ranbp17	A	T	11: 33,481,125	V284D	probably damaging	Het
Reln	T	C	5: 22,048,005	D648G	probably benign	Het
Rnf112	A	G	11: 61,452,279	L190P	probably damaging	Het
Scn5a	G	T	9: 119,485,612	P2010Q	probably benign	Het
Scn5a	T	C	9: 119,513,085	Y1138C	probably benign	Het
Slc4a9	A	G	18: 36,530,745	H274R	probably benign	Het
Slc5a6	T	G	5: 31,039,335	E391D	possibly damaging	Het
Speer2	T	C	16: 69,858,842	Q32R	possibly damaging	Het
Thsd7a	A	T	6: 12,337,268	L1250Q	possibly damaging	Het
Tnnt3	A	G	7: 142,512,564	Y222C	probably benign	Het
Trim40	T	C	17: 36,888,983	I68V	probably benign	Het
Trp53tg5	T	C	2: 164,471,306	I150V	probably benign	Het
Ube2u	T	C	4: 100,532,168	V109A	probably benign	Het
Usp54	A	T	14: 20,561,840	D969E	probably benign	Het
Vil1	G	T	1: 74,425,679	R495L	probably benign	Het
Wfs1	T	A	5: 36,967,220	K700*	probably null	Het
Zcchc8	A	G	5: 123,707,403	L298P	probably damaging	Het
Zfp946	A	T	17: 22,454,716	Q150H	possibly damaging	Het

Other mutations in Tars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Tars	APN	15	11388221	splice site	probably null
IGL00642:Tars	APN	15	11394372	missense	probably damaging	1.00
IGL01315:Tars	APN	15	11389734	nonsense	probably null
IGL01459:Tars	APN	15	11391854	missense	possibly damaging	0.76
IGL02141:Tars	APN	15	11391194	missense	probably damaging	0.96
IGL03292:Tars	APN	15	11384021	missense	probably benign	0.22
R0383:Tars	UTSW	15	11390325	missense	probably benign
R0517:Tars	UTSW	15	11394366	nonsense	probably null
R0685:Tars	UTSW	15	11385173	missense	probably benign
R1589:Tars	UTSW	15	11388175	missense	probably benign	0.32
R1753:Tars	UTSW	15	11394243	nonsense	probably null
R2051:Tars	UTSW	15	11393194	nonsense	probably null
R2060:Tars	UTSW	15	11394373	missense	probably benign	0.03
R3610:Tars	UTSW	15	11392904	missense	probably damaging	0.99
R4656:Tars	UTSW	15	11394264	missense	probably damaging	1.00
R4844:Tars	UTSW	15	11385195	missense	possibly damaging	0.85
R4974:Tars	UTSW	15	11390391	missense	probably damaging	1.00
R5551:Tars	UTSW	15	11391982	missense	probably damaging	0.97
R5992:Tars	UTSW	15	11397196	missense	probably damaging	1.00
R6742:Tars	UTSW	15	11394341	missense	probably damaging	0.98
R6778:Tars	UTSW	15	11389699	missense	probably benign	0.06
R6850:Tars	UTSW	15	11392799	missense	probably benign
R7270:Tars	UTSW	15	11392019	missense	probably benign	0.00
R7401:Tars	UTSW	15	11392009	nonsense	probably null
R7743:Tars	UTSW	15	11399372	splice site	probably null
R8062:Tars	UTSW	15	11388314	missense	possibly damaging	0.78
R8852:Tars	UTSW	15	11393262	missense	probably benign	0.02
R8942:Tars	UTSW	15	11384097	missense	probably benign	0.27
R9205:Tars	UTSW	15	11397179	critical splice donor site	probably null
R9362:Tars	UTSW	15	11387530	missense	probably damaging	1.00
Z1088:Tars	UTSW	15	11391884	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- CTTCCCTATCAATGCAGAGCTG -3'
(R):5'- TCCATGAGTTTTGGTGCACC -3'

Sequencing Primer
(F):5'- AGGTTAAGAGCCTTGCTACTC -3'
(R):5'- GTGCACCACCTACAGATGG -3'

Posted On

2014-10-15