Incidental Mutation 'R2216:Prkag1'
ID241179
Institutional Source Beutler Lab
Gene Symbol Prkag1
Ensembl Gene ENSMUSG00000067713
Gene Nameprotein kinase, AMP-activated, gamma 1 non-catalytic subunit
SynonymsPrkaac
MMRRC Submission 040218-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R2216 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98812797-98831521 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 98815946 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000155433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168846] [ENSMUST00000229297] [ENSMUST00000230560]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168846
AA Change: M32K

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132499
Gene: ENSMUSG00000067713
AA Change: M32K

DomainStartEndE-ValueType
CBS 46 95 8.18e-7 SMART
CBS 127 176 3.12e-12 SMART
CBS 202 250 1.01e-11 SMART
CBS 274 322 2.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181510
Predicted Effect probably null
Transcript: ENSMUST00000229297
AA Change: M1K

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230113
Predicted Effect probably null
Transcript: ENSMUST00000230560
AA Change: M1K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hemolytic anemia, extramedullary hematopoiesis, and iron accumulation in the spleen, liver, and Kupffer cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 72,031,446 P146T probably damaging Het
Arnt2 T A 7: 84,275,351 T423S probably damaging Het
Bend5 A G 4: 111,448,590 N277S probably null Het
Cd22 G T 7: 30,867,046 T816N probably damaging Het
Cep126 G A 9: 8,120,678 R115C probably damaging Het
Cep85 T C 4: 134,131,430 H710R possibly damaging Het
Cmya5 A T 13: 93,093,495 L1695H probably damaging Het
Col24a1 T C 3: 145,314,981 V371A probably benign Het
Csmd1 T A 8: 17,027,339 probably null Het
Cyp1a1 T A 9: 57,702,069 probably null Het
Dennd1c C T 17: 57,074,492 probably null Het
Dmxl1 G A 18: 49,893,923 V2033I probably benign Het
Dtna A G 18: 23,569,565 H51R probably damaging Het
Dysf G A 6: 84,207,245 probably null Het
Gcn1l1 T A 5: 115,593,661 V945E probably benign Het
Gm12800 T A 4: 101,910,060 W169R probably damaging Het
Gpbar1 C G 1: 74,278,894 L99V probably damaging Het
Hdac9 A T 12: 34,429,517 D212E probably damaging Het
Itga1 A T 13: 114,997,029 D448E probably benign Het
Itga2b T A 11: 102,467,866 N75I probably benign Het
Klra7 T C 6: 130,228,586 E117G probably benign Het
Kmt2b G A 7: 30,574,065 R2349C probably benign Het
Masp1 T C 16: 23,492,055 N209S probably benign Het
Mybpc2 C T 7: 44,512,500 probably null Het
Myh15 C G 16: 49,165,838 S1557* probably null Het
Myo3a A C 2: 22,577,771 T346P probably benign Het
Nim1k A G 13: 119,714,215 Y152H probably damaging Het
Nrp2 C T 1: 62,762,918 R507* probably null Het
Olfr513 C T 7: 108,755,612 T252M probably damaging Het
Olfr702 T A 7: 106,823,998 H176L probably damaging Het
Parp14 T C 16: 35,857,205 I798V probably benign Het
Pcnx2 C T 8: 125,888,077 A212T probably benign Het
Pkhd1l1 A T 15: 44,573,895 H3522L probably damaging Het
Pram1 C T 17: 33,641,284 A275V probably benign Het
Prss52 T C 14: 64,113,593 S276P probably damaging Het
Ranbp17 A T 11: 33,481,125 V284D probably damaging Het
Reln T C 5: 22,048,005 D648G probably benign Het
Rnf112 A G 11: 61,452,279 L190P probably damaging Het
Scn5a G T 9: 119,485,612 P2010Q probably benign Het
Scn5a T C 9: 119,513,085 Y1138C probably benign Het
Slc4a9 A G 18: 36,530,745 H274R probably benign Het
Slc5a6 T G 5: 31,039,335 E391D possibly damaging Het
Speer2 T C 16: 69,858,842 Q32R possibly damaging Het
Tars A G 15: 11,389,708 V372A probably benign Het
Thsd7a A T 6: 12,337,268 L1250Q possibly damaging Het
Tnnt3 A G 7: 142,512,564 Y222C probably benign Het
Trim40 T C 17: 36,888,983 I68V probably benign Het
Trp53tg5 T C 2: 164,471,306 I150V probably benign Het
Ube2u T C 4: 100,532,168 V109A probably benign Het
Usp54 A T 14: 20,561,840 D969E probably benign Het
Vil1 G T 1: 74,425,679 R495L probably benign Het
Wfs1 T A 5: 36,967,220 K700* probably null Het
Zcchc8 A G 5: 123,707,403 L298P probably damaging Het
Zfp946 A T 17: 22,454,716 Q150H possibly damaging Het
Other mutations in Prkag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Prkag1 APN 15 98814531 missense probably damaging 1.00
IGL02621:Prkag1 APN 15 98814028 missense probably damaging 1.00
IGL02804:Prkag1 APN 15 98815504 missense probably damaging 1.00
IGL03197:Prkag1 APN 15 98815177 splice site probably benign
R0328:Prkag1 UTSW 15 98815682 missense probably damaging 1.00
R1188:Prkag1 UTSW 15 98814598 missense probably damaging 0.99
R1493:Prkag1 UTSW 15 98813670 missense probably benign 0.02
R1663:Prkag1 UTSW 15 98815895 missense probably damaging 1.00
R2115:Prkag1 UTSW 15 98814552 missense probably damaging 1.00
R5037:Prkag1 UTSW 15 98815887 missense possibly damaging 0.51
R5175:Prkag1 UTSW 15 98815715 missense possibly damaging 0.82
R5597:Prkag1 UTSW 15 98815908 missense probably damaging 1.00
R6185:Prkag1 UTSW 15 98825714 missense probably benign 0.00
R6359:Prkag1 UTSW 15 98814552 missense probably damaging 1.00
R6429:Prkag1 UTSW 15 98814523 missense probably damaging 1.00
R7777:Prkag1 UTSW 15 98814597 missense probably damaging 1.00
R8432:Prkag1 UTSW 15 98815544 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTAAGGAGATCCATAGAGGGCAC -3'
(R):5'- AGGAAGCTGGACGTGGTGT -3'

Sequencing Primer
(F):5'- GATCCATAGAGGGCACAGCTTC -3'
(R):5'- GACGTGGTGTCTCGAAAAAC -3'
Posted On2014-10-15