Mutagenetix > Incidental Mutation

Incidental Mutation 'R2216:Masp1'

241180

Institutional Source

Beutler Lab

Gene Symbol

Masp1

Ensembl Gene

ENSMUSG00000022887

Gene Name

mannan-binding lectin serine peptidase 1

Synonyms

Crarf

MMRRC Submission

040218-MU

Accession Numbers

Genbank: NM_008555; MGI: 88492

Essential gene?

Probably non essential (E-score: 0.214) question?

Stock #

R2216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23449417-23520815 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23492055 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 209 (N209S)

Ref Sequence

ENSEMBL: ENSMUSP00000155665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089883] [ENSMUST00000229619] [ENSMUST00000230040]

AlphaFold

P98064

Predicted Effect

probably benign
Transcript: ENSMUST00000089883
AA Change: N209S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: N209S

Domain	Start	End	E-Value	Type
low complexity region	9	19	N/A	INTRINSIC
CUB	23	143	2.96e-36	SMART
EGF_CA	144	187	1.46e-7	SMART
CUB	190	302	1.49e-41	SMART
CCP	306	367	4.41e-12	SMART
CCP	372	437	3.05e-6	SMART
Tryp_SPc	453	696	4.66e-84	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229152

Predicted Effect

probably benign
Transcript: ENSMUST00000229619
AA Change: N209S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

probably benign
Transcript: ENSMUST00000230040
AA Change: N209S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aipl1	G	T	11: 72,031,446	P146T	probably damaging	Het
Arnt2	T	A	7: 84,275,351	T423S	probably damaging	Het
Bend5	A	G	4: 111,448,590	N277S	probably null	Het
Cd22	G	T	7: 30,867,046	T816N	probably damaging	Het
Cep126	G	A	9: 8,120,678	R115C	probably damaging	Het
Cep85	T	C	4: 134,131,430	H710R	possibly damaging	Het
Cmya5	A	T	13: 93,093,495	L1695H	probably damaging	Het
Col24a1	T	C	3: 145,314,981	V371A	probably benign	Het
Csmd1	T	A	8: 17,027,339		probably null	Het
Cyp1a1	T	A	9: 57,702,069		probably null	Het
Dennd1c	C	T	17: 57,074,492		probably null	Het
Dmxl1	G	A	18: 49,893,923	V2033I	probably benign	Het
Dtna	A	G	18: 23,569,565	H51R	probably damaging	Het
Dysf	G	A	6: 84,207,245		probably null	Het
Gcn1l1	T	A	5: 115,593,661	V945E	probably benign	Het
Gm12800	T	A	4: 101,910,060	W169R	probably damaging	Het
Gpbar1	C	G	1: 74,278,894	L99V	probably damaging	Het
Hdac9	A	T	12: 34,429,517	D212E	probably damaging	Het
Itga1	A	T	13: 114,997,029	D448E	probably benign	Het
Itga2b	T	A	11: 102,467,866	N75I	probably benign	Het
Klra7	T	C	6: 130,228,586	E117G	probably benign	Het
Kmt2b	G	A	7: 30,574,065	R2349C	probably benign	Het
Mybpc2	C	T	7: 44,512,500		probably null	Het
Myh15	C	G	16: 49,165,838	S1557*	probably null	Het
Myo3a	A	C	2: 22,577,771	T346P	probably benign	Het
Nim1k	A	G	13: 119,714,215	Y152H	probably damaging	Het
Nrp2	C	T	1: 62,762,918	R507*	probably null	Het
Olfr513	C	T	7: 108,755,612	T252M	probably damaging	Het
Olfr702	T	A	7: 106,823,998	H176L	probably damaging	Het
Parp14	T	C	16: 35,857,205	I798V	probably benign	Het
Pcnx2	C	T	8: 125,888,077	A212T	probably benign	Het
Pkhd1l1	A	T	15: 44,573,895	H3522L	probably damaging	Het
Pram1	C	T	17: 33,641,284	A275V	probably benign	Het
Prkag1	A	T	15: 98,815,946	M1K	probably null	Het
Prss52	T	C	14: 64,113,593	S276P	probably damaging	Het
Ranbp17	A	T	11: 33,481,125	V284D	probably damaging	Het
Reln	T	C	5: 22,048,005	D648G	probably benign	Het
Rnf112	A	G	11: 61,452,279	L190P	probably damaging	Het
Scn5a	G	T	9: 119,485,612	P2010Q	probably benign	Het
Scn5a	T	C	9: 119,513,085	Y1138C	probably benign	Het
Slc4a9	A	G	18: 36,530,745	H274R	probably benign	Het
Slc5a6	T	G	5: 31,039,335	E391D	possibly damaging	Het
Speer2	T	C	16: 69,858,842	Q32R	possibly damaging	Het
Tars	A	G	15: 11,389,708	V372A	probably benign	Het
Thsd7a	A	T	6: 12,337,268	L1250Q	possibly damaging	Het
Tnnt3	A	G	7: 142,512,564	Y222C	probably benign	Het
Trim40	T	C	17: 36,888,983	I68V	probably benign	Het
Trp53tg5	T	C	2: 164,471,306	I150V	probably benign	Het
Ube2u	T	C	4: 100,532,168	V109A	probably benign	Het
Usp54	A	T	14: 20,561,840	D969E	probably benign	Het
Vil1	G	T	1: 74,425,679	R495L	probably benign	Het
Wfs1	T	A	5: 36,967,220	K700*	probably null	Het
Zcchc8	A	G	5: 123,707,403	L298P	probably damaging	Het
Zfp946	A	T	17: 22,454,716	Q150H	possibly damaging	Het

Other mutations in Masp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Masp1	APN	16	23458091	missense	possibly damaging	0.93
IGL00428:Masp1	APN	16	23476312	missense	probably damaging	1.00
IGL00432:Masp1	APN	16	23513851	missense	probably damaging	1.00
IGL02598:Masp1	APN	16	23459631	missense	probably benign
IGL02718:Masp1	APN	16	23476293	missense	probably damaging	1.00
IGL02947:Masp1	APN	16	23494726	missense	probably damaging	0.99
A4554:Masp1	UTSW	16	23454940	splice site	probably null
PIT1430001:Masp1	UTSW	16	23513944	missense	probably damaging	1.00
R0103:Masp1	UTSW	16	23458018	missense	probably damaging	1.00
R0505:Masp1	UTSW	16	23458138	missense	probably benign
R0630:Masp1	UTSW	16	23452419	missense	probably benign	0.01
R1146:Masp1	UTSW	16	23492115	missense	probably damaging	1.00
R1146:Masp1	UTSW	16	23492115	missense	probably damaging	1.00
R1339:Masp1	UTSW	16	23452467	missense	probably damaging	1.00
R1521:Masp1	UTSW	16	23494637	missense	probably damaging	1.00
R1588:Masp1	UTSW	16	23494654	missense	probably damaging	1.00
R1961:Masp1	UTSW	16	23452932	missense	probably damaging	1.00
R1986:Masp1	UTSW	16	23483461	missense	probably benign	0.01
R2080:Masp1	UTSW	16	23491959	missense	probably damaging	1.00
R2215:Masp1	UTSW	16	23452521	missense	possibly damaging	0.92
R2443:Masp1	UTSW	16	23476312	missense	probably damaging	1.00
R4934:Masp1	UTSW	16	23465076	missense	probably damaging	0.98
R5224:Masp1	UTSW	16	23494695	missense	probably damaging	1.00
R5340:Masp1	UTSW	16	23458108	missense	probably damaging	1.00
R5562:Masp1	UTSW	16	23465167	splice site	probably null
R5663:Masp1	UTSW	16	23452938	missense	possibly damaging	0.57
R5742:Masp1	UTSW	16	23454925	missense	probably benign	0.01
R5763:Masp1	UTSW	16	23496247	missense	probably damaging	1.00
R5898:Masp1	UTSW	16	23491927	missense	probably damaging	0.99
R6901:Masp1	UTSW	16	23513834	missense	probably damaging	0.99
R6987:Masp1	UTSW	16	23513915	missense	probably damaging	1.00
R7069:Masp1	UTSW	16	23452455	missense	probably benign	0.20
R7356:Masp1	UTSW	16	23470243	missense	possibly damaging	0.50
R7512:Masp1	UTSW	16	23470124	missense	probably damaging	1.00
R7539:Masp1	UTSW	16	23470378	missense	possibly damaging	0.94
R7810:Masp1	UTSW	16	23476318	missense	probably benign	0.01
R8026:Masp1	UTSW	16	23484406	missense	probably damaging	1.00
R8391:Masp1	UTSW	16	23470378	missense	possibly damaging	0.94
R8438:Masp1	UTSW	16	23470403	missense	probably benign	0.38
R8475:Masp1	UTSW	16	23452531	missense	probably damaging	0.99
R8870:Masp1	UTSW	16	23496132	missense	probably damaging	1.00
R9052:Masp1	UTSW	16	23520600	start gained	probably benign
R9072:Masp1	UTSW	16	23469921	missense	probably benign	0.07
R9073:Masp1	UTSW	16	23469921	missense	probably benign	0.07
R9599:Masp1	UTSW	16	23452948	missense	probably benign	0.16
R9686:Masp1	UTSW	16	23496137	missense	probably damaging	1.00
X0065:Masp1	UTSW	16	23513969	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCAATTGAGCCAAGATGCAC -3'
(R):5'- GCTTCCTGGGAACACTGAAAAG -3'

Sequencing Primer
(F):5'- TTGAGCCAAGATGCACCCTTG -3'
(R):5'- CTTCCTGGGAACACTGAAAAGATTAC -3'

Posted On

2014-10-15