Incidental Mutation 'R2216:Parp14'
ID 241181
Institutional Source Beutler Lab
Gene Symbol Parp14
Ensembl Gene ENSMUSG00000034422
Gene Name poly (ADP-ribose) polymerase family, member 14
Synonyms CoaSt6, collaborator of Stat6, 1600029O10Rik
MMRRC Submission 040218-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.466) question?
Stock # R2216 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 35653244-35691914 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35677575 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 798 (I798V)
Ref Sequence ENSEMBL: ENSMUSP00000037657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042665]
AlphaFold Q2EMV9
PDB Structure Solution structure of WWE domain in Parp14 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000042665
AA Change: I798V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000037657
Gene: ENSMUSG00000034422
AA Change: I798V

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
RRM 228 297 4.71e-2 SMART
coiled coil region 443 468 N/A INTRINSIC
Blast:A1pp 693 746 6e-6 BLAST
low complexity region 771 795 N/A INTRINSIC
A1pp 814 948 7.62e-41 SMART
A1pp 1026 1160 5.88e-24 SMART
A1pp 1239 1358 6.82e-20 SMART
PDB:1X4R|A 1532 1619 9e-53 PDB
Pfam:PARP 1632 1817 2.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142946
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase (PARP) protein family. The encoded anti-apoptotic protein may regulate aerobic glycolysis and promote survival of cancer cells. Increased expression of this gene has been reported in a variety of tumor types. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit altered B cell subsets and inability to respond to the apoptosis protective affects of IL4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 71,922,272 (GRCm39) P146T probably damaging Het
Arnt2 T A 7: 83,924,559 (GRCm39) T423S probably damaging Het
Bend5 A G 4: 111,305,787 (GRCm39) N277S probably null Het
Cd22 G T 7: 30,566,471 (GRCm39) T816N probably damaging Het
Cep126 G A 9: 8,120,679 (GRCm39) R115C probably damaging Het
Cep85 T C 4: 133,858,741 (GRCm39) H710R possibly damaging Het
Cmya5 A T 13: 93,230,003 (GRCm39) L1695H probably damaging Het
Col24a1 T C 3: 145,020,742 (GRCm39) V371A probably benign Het
Csmd1 T A 8: 17,077,355 (GRCm39) probably null Het
Cyp1a1 T A 9: 57,609,352 (GRCm39) probably null Het
Dennd1c C T 17: 57,381,492 (GRCm39) probably null Het
Dmxl1 G A 18: 50,026,990 (GRCm39) V2033I probably benign Het
Dtna A G 18: 23,702,622 (GRCm39) H51R probably damaging Het
Dysf G A 6: 84,184,227 (GRCm39) probably null Het
Gcn1 T A 5: 115,731,720 (GRCm39) V945E probably benign Het
Gpbar1 C G 1: 74,318,053 (GRCm39) L99V probably damaging Het
Hdac9 A T 12: 34,479,516 (GRCm39) D212E probably damaging Het
Itga1 A T 13: 115,133,565 (GRCm39) D448E probably benign Het
Itga2b T A 11: 102,358,692 (GRCm39) N75I probably benign Het
Klra7 T C 6: 130,205,549 (GRCm39) E117G probably benign Het
Kmt2b G A 7: 30,273,490 (GRCm39) R2349C probably benign Het
Masp1 T C 16: 23,310,805 (GRCm39) N209S probably benign Het
Mybpc2 C T 7: 44,161,924 (GRCm39) probably null Het
Myh15 C G 16: 48,986,201 (GRCm39) S1557* probably null Het
Myo3a A C 2: 22,467,783 (GRCm39) T346P probably benign Het
Nim1k A G 13: 120,175,751 (GRCm39) Y152H probably damaging Het
Nrp2 C T 1: 62,802,077 (GRCm39) R507* probably null Het
Or13n4 T A 7: 106,423,205 (GRCm39) H176L probably damaging Het
Or5e1 C T 7: 108,354,819 (GRCm39) T252M probably damaging Het
Pcnx2 C T 8: 126,614,816 (GRCm39) A212T probably benign Het
Pkhd1l1 A T 15: 44,437,291 (GRCm39) H3522L probably damaging Het
Pram1 C T 17: 33,860,258 (GRCm39) A275V probably benign Het
Pramel18 T A 4: 101,767,257 (GRCm39) W169R probably damaging Het
Prkag1 A T 15: 98,713,827 (GRCm39) M1K probably null Het
Prss52 T C 14: 64,351,042 (GRCm39) S276P probably damaging Het
Ranbp17 A T 11: 33,431,125 (GRCm39) V284D probably damaging Het
Reln T C 5: 22,253,003 (GRCm39) D648G probably benign Het
Rnf112 A G 11: 61,343,105 (GRCm39) L190P probably damaging Het
Scn5a G T 9: 119,314,678 (GRCm39) P2010Q probably benign Het
Scn5a T C 9: 119,342,151 (GRCm39) Y1138C probably benign Het
Slc4a9 A G 18: 36,663,798 (GRCm39) H274R probably benign Het
Slc5a6 T G 5: 31,196,679 (GRCm39) E391D possibly damaging Het
Speer2 T C 16: 69,655,730 (GRCm39) Q32R possibly damaging Het
Tars1 A G 15: 11,389,794 (GRCm39) V372A probably benign Het
Thsd7a A T 6: 12,337,267 (GRCm39) L1250Q possibly damaging Het
Tnnt3 A G 7: 142,066,301 (GRCm39) Y222C probably benign Het
Trim40 T C 17: 37,199,875 (GRCm39) I68V probably benign Het
Trp53tg5 T C 2: 164,313,226 (GRCm39) I150V probably benign Het
Ube2u T C 4: 100,389,365 (GRCm39) V109A probably benign Het
Usp54 A T 14: 20,611,908 (GRCm39) D969E probably benign Het
Vil1 G T 1: 74,464,838 (GRCm39) R495L probably benign Het
Wfs1 T A 5: 37,124,564 (GRCm39) K700* probably null Het
Zcchc8 A G 5: 123,845,466 (GRCm39) L298P probably damaging Het
Zfp946 A T 17: 22,673,697 (GRCm39) Q150H possibly damaging Het
Other mutations in Parp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Parp14 APN 16 35,661,445 (GRCm39) missense probably benign 0.00
IGL00497:Parp14 APN 16 35,655,206 (GRCm39) missense probably damaging 1.00
IGL00754:Parp14 APN 16 35,659,741 (GRCm39) missense probably benign 0.15
IGL00960:Parp14 APN 16 35,661,589 (GRCm39) missense probably benign 0.20
IGL01321:Parp14 APN 16 35,676,929 (GRCm39) missense probably benign
IGL01397:Parp14 APN 16 35,679,098 (GRCm39) missense probably benign 0.19
IGL01591:Parp14 APN 16 35,678,877 (GRCm39) missense possibly damaging 0.71
IGL01728:Parp14 APN 16 35,677,805 (GRCm39) missense probably damaging 1.00
IGL01734:Parp14 APN 16 35,678,970 (GRCm39) missense probably benign 0.00
IGL02156:Parp14 APN 16 35,678,967 (GRCm39) missense probably benign 0.13
IGL02951:Parp14 APN 16 35,678,903 (GRCm39) missense probably benign 0.06
IGL03067:Parp14 APN 16 35,676,878 (GRCm39) missense probably benign 0.10
IGL03135:Parp14 APN 16 35,678,381 (GRCm39) missense probably damaging 1.00
IGL03141:Parp14 APN 16 35,659,663 (GRCm39) missense probably benign 0.00
IGL03146:Parp14 APN 16 35,678,823 (GRCm39) nonsense probably null
IGL03333:Parp14 APN 16 35,661,800 (GRCm39) missense probably benign 0.08
IGL03391:Parp14 APN 16 35,678,640 (GRCm39) missense probably benign
thurston UTSW 16 35,664,785 (GRCm39) splice site probably benign
PIT4585001:Parp14 UTSW 16 35,678,975 (GRCm39) missense probably benign 0.03
R0306:Parp14 UTSW 16 35,676,944 (GRCm39) missense probably benign
R0506:Parp14 UTSW 16 35,661,779 (GRCm39) missense possibly damaging 0.70
R0586:Parp14 UTSW 16 35,661,382 (GRCm39) missense probably benign 0.00
R0606:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R0612:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R0699:Parp14 UTSW 16 35,680,955 (GRCm39) missense probably damaging 1.00
R0786:Parp14 UTSW 16 35,661,172 (GRCm39) missense possibly damaging 0.86
R0883:Parp14 UTSW 16 35,678,888 (GRCm39) missense probably benign 0.03
R0900:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1087:Parp14 UTSW 16 35,678,658 (GRCm39) missense probably damaging 1.00
R1104:Parp14 UTSW 16 35,664,785 (GRCm39) splice site probably benign
R1120:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1134:Parp14 UTSW 16 35,655,272 (GRCm39) missense probably damaging 1.00
R1153:Parp14 UTSW 16 35,678,041 (GRCm39) missense possibly damaging 0.49
R1159:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1160:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1237:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1238:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1239:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1423:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1511:Parp14 UTSW 16 35,677,594 (GRCm39) missense probably benign 0.00
R1518:Parp14 UTSW 16 35,677,008 (GRCm39) missense possibly damaging 0.79
R1619:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1707:Parp14 UTSW 16 35,678,219 (GRCm39) missense probably damaging 1.00
R1792:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1831:Parp14 UTSW 16 35,678,958 (GRCm39) missense possibly damaging 0.77
R1840:Parp14 UTSW 16 35,683,819 (GRCm39) missense probably damaging 1.00
R1889:Parp14 UTSW 16 35,677,130 (GRCm39) missense probably benign 0.09
R1902:Parp14 UTSW 16 35,673,888 (GRCm39) critical splice donor site probably null
R1943:Parp14 UTSW 16 35,656,499 (GRCm39) missense probably damaging 1.00
R1954:Parp14 UTSW 16 35,678,671 (GRCm39) missense probably benign 0.08
R2115:Parp14 UTSW 16 35,678,904 (GRCm39) missense probably benign 0.16
R2519:Parp14 UTSW 16 35,678,573 (GRCm39) missense possibly damaging 0.95
R3851:Parp14 UTSW 16 35,674,118 (GRCm39) missense possibly damaging 0.92
R4052:Parp14 UTSW 16 35,678,771 (GRCm39) missense probably benign 0.05
R4671:Parp14 UTSW 16 35,678,691 (GRCm39) missense probably benign 0.00
R4867:Parp14 UTSW 16 35,677,697 (GRCm39) missense probably benign 0.01
R4941:Parp14 UTSW 16 35,666,403 (GRCm39) missense probably benign
R4992:Parp14 UTSW 16 35,661,512 (GRCm39) missense probably benign 0.05
R5055:Parp14 UTSW 16 35,664,733 (GRCm39) missense probably benign 0.00
R5073:Parp14 UTSW 16 35,655,077 (GRCm39) missense probably damaging 0.99
R5170:Parp14 UTSW 16 35,677,649 (GRCm39) missense probably benign 0.21
R5422:Parp14 UTSW 16 35,686,545 (GRCm39) missense probably benign 0.01
R5543:Parp14 UTSW 16 35,655,137 (GRCm39) missense probably benign 0.00
R5549:Parp14 UTSW 16 35,661,505 (GRCm39) missense probably benign 0.00
R5553:Parp14 UTSW 16 35,677,306 (GRCm39) missense probably benign 0.01
R5691:Parp14 UTSW 16 35,683,909 (GRCm39) missense probably benign 0.12
R5774:Parp14 UTSW 16 35,678,780 (GRCm39) missense probably damaging 1.00
R5855:Parp14 UTSW 16 35,661,297 (GRCm39) nonsense probably null
R5942:Parp14 UTSW 16 35,659,737 (GRCm39) missense probably damaging 0.98
R5990:Parp14 UTSW 16 35,661,827 (GRCm39) missense probably benign 0.14
R5991:Parp14 UTSW 16 35,661,827 (GRCm39) missense probably benign 0.14
R6018:Parp14 UTSW 16 35,661,827 (GRCm39) missense probably benign 0.14
R6022:Parp14 UTSW 16 35,661,827 (GRCm39) missense probably benign 0.14
R6075:Parp14 UTSW 16 35,677,389 (GRCm39) missense probably damaging 0.99
R6395:Parp14 UTSW 16 35,676,918 (GRCm39) missense probably benign 0.00
R6525:Parp14 UTSW 16 35,680,811 (GRCm39) missense probably benign 0.05
R6683:Parp14 UTSW 16 35,655,047 (GRCm39) missense probably damaging 1.00
R7525:Parp14 UTSW 16 35,677,861 (GRCm39) missense probably benign 0.00
R8011:Parp14 UTSW 16 35,677,004 (GRCm39) missense probably benign 0.00
R8192:Parp14 UTSW 16 35,691,584 (GRCm39) missense probably benign 0.01
R8367:Parp14 UTSW 16 35,678,124 (GRCm39) missense probably benign 0.36
R8526:Parp14 UTSW 16 35,661,307 (GRCm39) missense possibly damaging 0.87
R8751:Parp14 UTSW 16 35,677,181 (GRCm39) missense probably benign 0.32
R8962:Parp14 UTSW 16 35,677,187 (GRCm39) missense probably damaging 1.00
R9231:Parp14 UTSW 16 35,661,583 (GRCm39) missense probably damaging 0.98
R9363:Parp14 UTSW 16 35,678,586 (GRCm39) missense possibly damaging 0.90
R9366:Parp14 UTSW 16 35,659,630 (GRCm39) critical splice donor site probably null
R9379:Parp14 UTSW 16 35,680,853 (GRCm39) missense probably benign 0.08
R9562:Parp14 UTSW 16 35,677,775 (GRCm39) missense probably benign 0.16
R9565:Parp14 UTSW 16 35,677,775 (GRCm39) missense probably benign 0.16
R9696:Parp14 UTSW 16 35,661,252 (GRCm39) missense probably damaging 0.96
R9696:Parp14 UTSW 16 35,661,251 (GRCm39) missense possibly damaging 0.67
X0026:Parp14 UTSW 16 35,677,527 (GRCm39) nonsense probably null
X0060:Parp14 UTSW 16 35,655,077 (GRCm39) missense probably damaging 0.99
Z1088:Parp14 UTSW 16 35,661,956 (GRCm39) missense probably damaging 1.00
Z1177:Parp14 UTSW 16 35,665,708 (GRCm39) missense probably damaging 1.00
Z1177:Parp14 UTSW 16 35,691,573 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GATAACAGCATTGCCGGGTAG -3'
(R):5'- ACTGACAAAGCTGGCGTCAG -3'

Sequencing Primer
(F):5'- ATTGCCGGGTAGGACCAC -3'
(R):5'- GCGTCAGGCACTTCTTCAAAG -3'
Posted On 2014-10-15