Incidental Mutation 'R2216:Zfp946'
ID241184
Institutional Source Beutler Lab
Gene Symbol Zfp946
Ensembl Gene ENSMUSG00000071266
Gene Namezinc finger protein 946
Synonyms
MMRRC Submission 040218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2216 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location22424222-22456689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22454716 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 150 (Q150H)
Ref Sequence ENSEMBL: ENSMUSP00000132940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088763] [ENSMUST00000120222] [ENSMUST00000167740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088763
AA Change: Q150H

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086141
Gene: ENSMUSG00000071266
AA Change: Q150H

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120222
AA Change: Q150H

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113244
Gene: ENSMUSG00000071266
AA Change: Q150H

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167740
AA Change: Q150H

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132940
Gene: ENSMUSG00000071266
AA Change: Q150H

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 72,031,446 P146T probably damaging Het
Arnt2 T A 7: 84,275,351 T423S probably damaging Het
Bend5 A G 4: 111,448,590 N277S probably null Het
Cd22 G T 7: 30,867,046 T816N probably damaging Het
Cep126 G A 9: 8,120,678 R115C probably damaging Het
Cep85 T C 4: 134,131,430 H710R possibly damaging Het
Cmya5 A T 13: 93,093,495 L1695H probably damaging Het
Col24a1 T C 3: 145,314,981 V371A probably benign Het
Csmd1 T A 8: 17,027,339 probably null Het
Cyp1a1 T A 9: 57,702,069 probably null Het
Dennd1c C T 17: 57,074,492 probably null Het
Dmxl1 G A 18: 49,893,923 V2033I probably benign Het
Dtna A G 18: 23,569,565 H51R probably damaging Het
Dysf G A 6: 84,207,245 probably null Het
Gcn1l1 T A 5: 115,593,661 V945E probably benign Het
Gm12800 T A 4: 101,910,060 W169R probably damaging Het
Gpbar1 C G 1: 74,278,894 L99V probably damaging Het
Hdac9 A T 12: 34,429,517 D212E probably damaging Het
Itga1 A T 13: 114,997,029 D448E probably benign Het
Itga2b T A 11: 102,467,866 N75I probably benign Het
Klra7 T C 6: 130,228,586 E117G probably benign Het
Kmt2b G A 7: 30,574,065 R2349C probably benign Het
Masp1 T C 16: 23,492,055 N209S probably benign Het
Mybpc2 C T 7: 44,512,500 probably null Het
Myh15 C G 16: 49,165,838 S1557* probably null Het
Myo3a A C 2: 22,577,771 T346P probably benign Het
Nim1k A G 13: 119,714,215 Y152H probably damaging Het
Nrp2 C T 1: 62,762,918 R507* probably null Het
Olfr513 C T 7: 108,755,612 T252M probably damaging Het
Olfr702 T A 7: 106,823,998 H176L probably damaging Het
Parp14 T C 16: 35,857,205 I798V probably benign Het
Pcnx2 C T 8: 125,888,077 A212T probably benign Het
Pkhd1l1 A T 15: 44,573,895 H3522L probably damaging Het
Pram1 C T 17: 33,641,284 A275V probably benign Het
Prkag1 A T 15: 98,815,946 M1K probably null Het
Prss52 T C 14: 64,113,593 S276P probably damaging Het
Ranbp17 A T 11: 33,481,125 V284D probably damaging Het
Reln T C 5: 22,048,005 D648G probably benign Het
Rnf112 A G 11: 61,452,279 L190P probably damaging Het
Scn5a G T 9: 119,485,612 P2010Q probably benign Het
Scn5a T C 9: 119,513,085 Y1138C probably benign Het
Slc4a9 A G 18: 36,530,745 H274R probably benign Het
Slc5a6 T G 5: 31,039,335 E391D possibly damaging Het
Speer2 T C 16: 69,858,842 Q32R possibly damaging Het
Tars A G 15: 11,389,708 V372A probably benign Het
Thsd7a A T 6: 12,337,268 L1250Q possibly damaging Het
Tnnt3 A G 7: 142,512,564 Y222C probably benign Het
Trim40 T C 17: 36,888,983 I68V probably benign Het
Trp53tg5 T C 2: 164,471,306 I150V probably benign Het
Ube2u T C 4: 100,532,168 V109A probably benign Het
Usp54 A T 14: 20,561,840 D969E probably benign Het
Vil1 G T 1: 74,425,679 R495L probably benign Het
Wfs1 T A 5: 36,967,220 K700* probably null Het
Zcchc8 A G 5: 123,707,403 L298P probably damaging Het
Other mutations in Zfp946
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Zfp946 APN 17 22454662 missense possibly damaging 0.88
IGL01869:Zfp946 APN 17 22454703 missense probably benign 0.45
IGL02037:Zfp946 APN 17 22453488 missense probably damaging 1.00
IGL03111:Zfp946 APN 17 22454556 missense possibly damaging 0.76
R0324:Zfp946 UTSW 17 22454436 missense probably benign 0.41
R1252:Zfp946 UTSW 17 22453579 critical splice donor site probably null
R1733:Zfp946 UTSW 17 22453557 missense probably damaging 1.00
R1971:Zfp946 UTSW 17 22455425 missense probably damaging 1.00
R2064:Zfp946 UTSW 17 22455465 missense probably damaging 1.00
R2106:Zfp946 UTSW 17 22453485 missense probably benign 0.30
R3899:Zfp946 UTSW 17 22454550 missense probably benign 0.05
R3924:Zfp946 UTSW 17 22455701 missense probably benign 0.06
R4125:Zfp946 UTSW 17 22454567 nonsense probably null
R4493:Zfp946 UTSW 17 22451086 splice site probably null
R4694:Zfp946 UTSW 17 22455711 missense probably benign 0.16
R4924:Zfp946 UTSW 17 22455521 missense probably damaging 1.00
R4939:Zfp946 UTSW 17 22455437 missense probably damaging 1.00
R5020:Zfp946 UTSW 17 22455603 missense probably benign 0.03
R5248:Zfp946 UTSW 17 22454466 missense probably benign 0.12
R5547:Zfp946 UTSW 17 22454892 missense probably benign 0.00
R5551:Zfp946 UTSW 17 22455384 missense probably damaging 1.00
R5573:Zfp946 UTSW 17 22454695 nonsense probably null
R6048:Zfp946 UTSW 17 22454840 missense probably benign 0.03
R6080:Zfp946 UTSW 17 22455109 missense probably benign 0.00
R6198:Zfp946 UTSW 17 22454915 missense probably damaging 1.00
R6332:Zfp946 UTSW 17 22454538 missense probably damaging 1.00
R6766:Zfp946 UTSW 17 22455771 missense probably benign 0.01
R7132:Zfp946 UTSW 17 22454663 missense probably benign 0.41
R7248:Zfp946 UTSW 17 22453508 nonsense probably null
R7695:Zfp946 UTSW 17 22455021 missense probably benign 0.05
R8113:Zfp946 UTSW 17 22455500 missense probably damaging 1.00
X0065:Zfp946 UTSW 17 22455513 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCTTGCTAAAATCACCCATGC -3'
(R):5'- GGCAAAACAGTTGTCATGTTCAC -3'

Sequencing Primer
(F):5'- TTGCTAAAATCACCCATGCATCCAC -3'
(R):5'- GTCATGTTCACTACTTTTGCAAAG -3'
Posted On2014-10-15