Incidental Mutation 'R2216:Pram1'
ID 241185
Institutional Source Beutler Lab
Gene Symbol Pram1
Ensembl Gene ENSMUSG00000032739
Gene Name PML-RAR alpha-regulated adaptor molecule 1
Synonyms
MMRRC Submission 040218-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2216 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 33857030-33864680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 33860258 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 275 (A275V)
Ref Sequence ENSEMBL: ENSMUSP00000057065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052079] [ENSMUST00000087582] [ENSMUST00000114385] [ENSMUST00000116619] [ENSMUST00000139302] [ENSMUST00000148178]
AlphaFold Q6BCL1
Predicted Effect probably benign
Transcript: ENSMUST00000052079
AA Change: A275V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057065
Gene: ENSMUSG00000032739
AA Change: A275V

DomainStartEndE-ValueType
internal_repeat_1 15 151 3.3e-6 PROSPERO
internal_repeat_1 237 378 3.3e-6 PROSPERO
low complexity region 393 404 N/A INTRINSIC
low complexity region 445 453 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 480 486 N/A INTRINSIC
SH3 581 655 1.09e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087582
SMART Domains Protein: ENSMUSP00000084864
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.7e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 2e-50 BLAST
low complexity region 590 603 N/A INTRINSIC
RRM 614 685 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114385
SMART Domains Protein: ENSMUSP00000110027
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.5e-20 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 3.9e-5 PROSPERO
internal_repeat_2 479 581 3.9e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
internal_repeat_1 643 676 1.39e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000116619
Predicted Effect probably benign
Transcript: ENSMUST00000130946
SMART Domains Protein: ENSMUSP00000116671
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139302
SMART Domains Protein: ENSMUSP00000115787
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.4e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 8e-51 BLAST
low complexity region 590 603 N/A INTRINSIC
internal_repeat_1 611 635 5.49e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000148178
SMART Domains Protein: ENSMUSP00000120115
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.2e-22 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 6.64e-5 PROSPERO
internal_repeat_2 479 581 6.64e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
RRM 653 724 1.51e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166215
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to FYN binding protein (FYB/SLAP-130), an adaptor protein involved in T cell receptor mediated signaling. This gene is expressed and regulated during normal myelopoiesis. The expression of this gene is induced by retinoic acid and is inhibited by the expression of PML-RARalpha, a fusion protein of promyelocytic leukemia (PML) and the retinoic acid receptor-alpha (RARalpha). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have neutrophils that exhibit decreased adhesion-dependent reactive oxygen intermediate production and degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 71,922,272 (GRCm39) P146T probably damaging Het
Arnt2 T A 7: 83,924,559 (GRCm39) T423S probably damaging Het
Bend5 A G 4: 111,305,787 (GRCm39) N277S probably null Het
Cd22 G T 7: 30,566,471 (GRCm39) T816N probably damaging Het
Cep126 G A 9: 8,120,679 (GRCm39) R115C probably damaging Het
Cep85 T C 4: 133,858,741 (GRCm39) H710R possibly damaging Het
Cmya5 A T 13: 93,230,003 (GRCm39) L1695H probably damaging Het
Col24a1 T C 3: 145,020,742 (GRCm39) V371A probably benign Het
Csmd1 T A 8: 17,077,355 (GRCm39) probably null Het
Cyp1a1 T A 9: 57,609,352 (GRCm39) probably null Het
Dennd1c C T 17: 57,381,492 (GRCm39) probably null Het
Dmxl1 G A 18: 50,026,990 (GRCm39) V2033I probably benign Het
Dtna A G 18: 23,702,622 (GRCm39) H51R probably damaging Het
Dysf G A 6: 84,184,227 (GRCm39) probably null Het
Gcn1 T A 5: 115,731,720 (GRCm39) V945E probably benign Het
Gpbar1 C G 1: 74,318,053 (GRCm39) L99V probably damaging Het
Hdac9 A T 12: 34,479,516 (GRCm39) D212E probably damaging Het
Itga1 A T 13: 115,133,565 (GRCm39) D448E probably benign Het
Itga2b T A 11: 102,358,692 (GRCm39) N75I probably benign Het
Klra7 T C 6: 130,205,549 (GRCm39) E117G probably benign Het
Kmt2b G A 7: 30,273,490 (GRCm39) R2349C probably benign Het
Masp1 T C 16: 23,310,805 (GRCm39) N209S probably benign Het
Mybpc2 C T 7: 44,161,924 (GRCm39) probably null Het
Myh15 C G 16: 48,986,201 (GRCm39) S1557* probably null Het
Myo3a A C 2: 22,467,783 (GRCm39) T346P probably benign Het
Nim1k A G 13: 120,175,751 (GRCm39) Y152H probably damaging Het
Nrp2 C T 1: 62,802,077 (GRCm39) R507* probably null Het
Or13n4 T A 7: 106,423,205 (GRCm39) H176L probably damaging Het
Or5e1 C T 7: 108,354,819 (GRCm39) T252M probably damaging Het
Parp14 T C 16: 35,677,575 (GRCm39) I798V probably benign Het
Pcnx2 C T 8: 126,614,816 (GRCm39) A212T probably benign Het
Pkhd1l1 A T 15: 44,437,291 (GRCm39) H3522L probably damaging Het
Pramel18 T A 4: 101,767,257 (GRCm39) W169R probably damaging Het
Prkag1 A T 15: 98,713,827 (GRCm39) M1K probably null Het
Prss52 T C 14: 64,351,042 (GRCm39) S276P probably damaging Het
Ranbp17 A T 11: 33,431,125 (GRCm39) V284D probably damaging Het
Reln T C 5: 22,253,003 (GRCm39) D648G probably benign Het
Rnf112 A G 11: 61,343,105 (GRCm39) L190P probably damaging Het
Scn5a G T 9: 119,314,678 (GRCm39) P2010Q probably benign Het
Scn5a T C 9: 119,342,151 (GRCm39) Y1138C probably benign Het
Slc4a9 A G 18: 36,663,798 (GRCm39) H274R probably benign Het
Slc5a6 T G 5: 31,196,679 (GRCm39) E391D possibly damaging Het
Speer2 T C 16: 69,655,730 (GRCm39) Q32R possibly damaging Het
Tars1 A G 15: 11,389,794 (GRCm39) V372A probably benign Het
Thsd7a A T 6: 12,337,267 (GRCm39) L1250Q possibly damaging Het
Tnnt3 A G 7: 142,066,301 (GRCm39) Y222C probably benign Het
Trim40 T C 17: 37,199,875 (GRCm39) I68V probably benign Het
Trp53tg5 T C 2: 164,313,226 (GRCm39) I150V probably benign Het
Ube2u T C 4: 100,389,365 (GRCm39) V109A probably benign Het
Usp54 A T 14: 20,611,908 (GRCm39) D969E probably benign Het
Vil1 G T 1: 74,464,838 (GRCm39) R495L probably benign Het
Wfs1 T A 5: 37,124,564 (GRCm39) K700* probably null Het
Zcchc8 A G 5: 123,845,466 (GRCm39) L298P probably damaging Het
Zfp946 A T 17: 22,673,697 (GRCm39) Q150H possibly damaging Het
Other mutations in Pram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Pram1 APN 17 33,861,109 (GRCm39) missense possibly damaging 0.79
IGL01949:Pram1 APN 17 33,860,309 (GRCm39) missense probably damaging 0.99
IGL01983:Pram1 APN 17 33,859,835 (GRCm39) missense probably damaging 0.98
IGL03403:Pram1 APN 17 33,861,117 (GRCm39) missense probably damaging 0.99
R0100:Pram1 UTSW 17 33,860,373 (GRCm39) missense possibly damaging 0.56
R0412:Pram1 UTSW 17 33,860,480 (GRCm39) missense probably benign 0.24
R1915:Pram1 UTSW 17 33,860,131 (GRCm39) missense probably benign 0.34
R4177:Pram1 UTSW 17 33,860,203 (GRCm39) missense probably benign
R5007:Pram1 UTSW 17 33,864,411 (GRCm39) missense probably damaging 1.00
R5077:Pram1 UTSW 17 33,863,878 (GRCm39) nonsense probably null
R5381:Pram1 UTSW 17 33,860,600 (GRCm39) missense probably damaging 1.00
R6063:Pram1 UTSW 17 33,860,386 (GRCm39) nonsense probably null
R7815:Pram1 UTSW 17 33,861,106 (GRCm39) missense probably benign 0.17
R8239:Pram1 UTSW 17 33,860,241 (GRCm39) missense probably damaging 1.00
R8248:Pram1 UTSW 17 33,860,138 (GRCm39) missense probably benign 0.00
R9189:Pram1 UTSW 17 33,860,131 (GRCm39) missense probably benign 0.34
R9208:Pram1 UTSW 17 33,859,801 (GRCm39) missense probably benign 0.02
R9254:Pram1 UTSW 17 33,860,441 (GRCm39) missense probably damaging 1.00
R9379:Pram1 UTSW 17 33,860,441 (GRCm39) missense probably damaging 1.00
Z1177:Pram1 UTSW 17 33,860,573 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAGTACTTTTCCCAAGAAGC -3'
(R):5'- GAACCTTGCAGACTTCAGGC -3'

Sequencing Primer
(F):5'- GTACTTTTCCCAAGAAGCCACTG -3'
(R):5'- AGACTTCAGGCTCCGAGGATG -3'
Posted On 2014-10-15