Mutagenetix > Incidental Mutations

Incidental Mutation 'R2216:Slc4a9'

241189

Institutional Source

Beutler Lab

Gene Symbol

Slc4a9

Ensembl Gene

ENSMUSG00000024485

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter, member 9

Synonyms

AE4, D630024F24Rik

MMRRC Submission

040218-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R2216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36528157-36541293 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36530745 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 274 (H274R)

Ref Sequence

ENSEMBL: ENSMUSP00000111358 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074298] [ENSMUST00000115694]

AlphaFold

A0A494BA31

Predicted Effect

probably benign
Transcript: ENSMUST00000074298
AA Change: H274R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073910
Gene: ENSMUSG00000024485
AA Change: H274R

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
Pfam:Band_3_cyto	80	174	4.6e-19	PFAM
Pfam:Band_3_cyto	161	300	7.1e-45	PFAM
Pfam:HCO3_cotransp	367	788	2.7e-168	PFAM
transmembrane domain	794	816	N/A	INTRINSIC
low complexity region	830	853	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115694
AA Change: H274R

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000111358
Gene: ENSMUSG00000024485
AA Change: H274R

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
Pfam:Band_3_cyto	80	170	1.9e-15	PFAM
Pfam:Band_3_cyto	159	300	1e-38	PFAM
Pfam:HCO3_cotransp	349	805	3.1e-174	PFAM
Pfam:HCO3_cotransp	801	837	1.1e-11	PFAM
transmembrane domain	845	867	N/A	INTRINSIC
low complexity region	879	902	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in anion exchange. Expression of this gene is mostly limited to the kidney. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered ion exchange in intestinal epithelia and kidney. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aipl1	G	T	11: 72,031,446	P146T	probably damaging	Het
Arnt2	T	A	7: 84,275,351	T423S	probably damaging	Het
Bend5	A	G	4: 111,448,590	N277S	probably null	Het
Cd22	G	T	7: 30,867,046	T816N	probably damaging	Het
Cep126	G	A	9: 8,120,678	R115C	probably damaging	Het
Cep85	T	C	4: 134,131,430	H710R	possibly damaging	Het
Cmya5	A	T	13: 93,093,495	L1695H	probably damaging	Het
Col24a1	T	C	3: 145,314,981	V371A	probably benign	Het
Csmd1	T	A	8: 17,027,339		probably null	Het
Cyp1a1	T	A	9: 57,702,069		probably null	Het
Dennd1c	C	T	17: 57,074,492		probably null	Het
Dmxl1	G	A	18: 49,893,923	V2033I	probably benign	Het
Dtna	A	G	18: 23,569,565	H51R	probably damaging	Het
Dysf	G	A	6: 84,207,245		probably null	Het
Gcn1l1	T	A	5: 115,593,661	V945E	probably benign	Het
Gm12800	T	A	4: 101,910,060	W169R	probably damaging	Het
Gpbar1	C	G	1: 74,278,894	L99V	probably damaging	Het
Hdac9	A	T	12: 34,429,517	D212E	probably damaging	Het
Itga1	A	T	13: 114,997,029	D448E	probably benign	Het
Itga2b	T	A	11: 102,467,866	N75I	probably benign	Het
Klra7	T	C	6: 130,228,586	E117G	probably benign	Het
Kmt2b	G	A	7: 30,574,065	R2349C	probably benign	Het
Masp1	T	C	16: 23,492,055	N209S	probably benign	Het
Mybpc2	C	T	7: 44,512,500		probably null	Het
Myh15	C	G	16: 49,165,838	S1557*	probably null	Het
Myo3a	A	C	2: 22,577,771	T346P	probably benign	Het
Nim1k	A	G	13: 119,714,215	Y152H	probably damaging	Het
Nrp2	C	T	1: 62,762,918	R507*	probably null	Het
Olfr513	C	T	7: 108,755,612	T252M	probably damaging	Het
Olfr702	T	A	7: 106,823,998	H176L	probably damaging	Het
Parp14	T	C	16: 35,857,205	I798V	probably benign	Het
Pcnx2	C	T	8: 125,888,077	A212T	probably benign	Het
Pkhd1l1	A	T	15: 44,573,895	H3522L	probably damaging	Het
Pram1	C	T	17: 33,641,284	A275V	probably benign	Het
Prkag1	A	T	15: 98,815,946	M1K	probably null	Het
Prss52	T	C	14: 64,113,593	S276P	probably damaging	Het
Ranbp17	A	T	11: 33,481,125	V284D	probably damaging	Het
Reln	T	C	5: 22,048,005	D648G	probably benign	Het
Rnf112	A	G	11: 61,452,279	L190P	probably damaging	Het
Scn5a	G	T	9: 119,485,612	P2010Q	probably benign	Het
Scn5a	T	C	9: 119,513,085	Y1138C	probably benign	Het
Slc5a6	T	G	5: 31,039,335	E391D	possibly damaging	Het
Speer2	T	C	16: 69,858,842	Q32R	possibly damaging	Het
Tars	A	G	15: 11,389,708	V372A	probably benign	Het
Thsd7a	A	T	6: 12,337,268	L1250Q	possibly damaging	Het
Tnnt3	A	G	7: 142,512,564	Y222C	probably benign	Het
Trim40	T	C	17: 36,888,983	I68V	probably benign	Het
Trp53tg5	T	C	2: 164,471,306	I150V	probably benign	Het
Ube2u	T	C	4: 100,532,168	V109A	probably benign	Het
Usp54	A	T	14: 20,561,840	D969E	probably benign	Het
Vil1	G	T	1: 74,425,679	R495L	probably benign	Het
Wfs1	T	A	5: 36,967,220	K700*	probably null	Het
Zcchc8	A	G	5: 123,707,403	L298P	probably damaging	Het
Zfp946	A	T	17: 22,454,716	Q150H	possibly damaging	Het

Other mutations in Slc4a9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00792:Slc4a9	APN	18	36539596	splice site	probably benign
IGL01890:Slc4a9	APN	18	36529707	missense	possibly damaging	0.63
IGL01995:Slc4a9	APN	18	36539775	missense	possibly damaging	0.64
IGL02293:Slc4a9	APN	18	36533215	missense	probably benign	0.00
IGL02476:Slc4a9	APN	18	36535445	critical splice donor site	probably null
IGL02690:Slc4a9	APN	18	36531987	missense	probably damaging	1.00
IGL02726:Slc4a9	APN	18	36539617	missense	probably benign	0.24
IGL03003:Slc4a9	APN	18	36536893	missense	probably damaging	1.00
IGL03344:Slc4a9	APN	18	36535601	missense	probably damaging	1.00
IGL03410:Slc4a9	APN	18	36529687	missense	probably benign
R0025:Slc4a9	UTSW	18	36531666	splice site	probably benign
R0242:Slc4a9	UTSW	18	36533680	missense	probably damaging	1.00
R0242:Slc4a9	UTSW	18	36541233	missense	probably damaging	1.00
R0242:Slc4a9	UTSW	18	36533680	missense	probably damaging	1.00
R0242:Slc4a9	UTSW	18	36541233	missense	probably damaging	1.00
R0330:Slc4a9	UTSW	18	36535539	missense	probably damaging	1.00
R0457:Slc4a9	UTSW	18	36535418	missense	probably damaging	1.00
R0831:Slc4a9	UTSW	18	36535278	splice site	probably benign
R0989:Slc4a9	UTSW	18	36536867	nonsense	probably null
R1016:Slc4a9	UTSW	18	36531425	missense	probably benign	0.12
R1469:Slc4a9	UTSW	18	36531101	missense	probably benign
R1469:Slc4a9	UTSW	18	36531101	missense	probably benign
R1598:Slc4a9	UTSW	18	36528371	nonsense	probably null
R1710:Slc4a9	UTSW	18	36532022	missense	probably benign
R2041:Slc4a9	UTSW	18	36530793	missense	possibly damaging	0.93
R3899:Slc4a9	UTSW	18	36535563	missense	probably benign	0.09
R5236:Slc4a9	UTSW	18	36530847	missense	probably benign
R5902:Slc4a9	UTSW	18	36529333	splice site	probably null
R5902:Slc4a9	UTSW	18	36531507	missense	probably damaging	1.00
R5978:Slc4a9	UTSW	18	36535403	missense	probably damaging	1.00
R6438:Slc4a9	UTSW	18	36535687	missense	probably benign	0.00
R6452:Slc4a9	UTSW	18	36531459	missense	probably damaging	1.00
R7238:Slc4a9	UTSW	18	36529720	missense	probably benign	0.00
R7329:Slc4a9	UTSW	18	36540821	missense	possibly damaging	0.76
R7409:Slc4a9	UTSW	18	36530805	missense	probably damaging	0.99
R7649:Slc4a9	UTSW	18	36528377	missense	probably benign	0.16
R7694:Slc4a9	UTSW	18	36536849	missense	probably damaging	0.99
R7856:Slc4a9	UTSW	18	36528698	missense	probably benign	0.04
R8523:Slc4a9	UTSW	18	36532143	missense	possibly damaging	0.91
R9003:Slc4a9	UTSW	18	36540734	critical splice acceptor site	probably null
R9165:Slc4a9	UTSW	18	36533623	missense	probably benign	0.00
Z1177:Slc4a9	UTSW	18	36531428	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGCTGAAGTTTCCAGTTCACTG -3'
(R):5'- CCATAATCAAGGTGAAGATCGGC -3'

Sequencing Primer
(F):5'- TTCACTGCTGGCCCAAGGTAG -3'
(R):5'- TCGGCATGGAATTAAGCCC -3'

Posted On

2014-10-15